Template:SBB09 41163

From OpenWetWare
Jump to navigationJump to search

Douglas Densmore

Error creating thumbnail: File missing

Welcome to your project page!

For each part listed, you should:

  • Design oligos to make your part
  • Write up proper construction files and put it on the Construction Files page
  • Put your oligos on the Oligo Log page
  • Put your part sequence on the part document
  • Name your parts according to the list here

Invasin (refactored, long)

 Source: plasmid pAC-TetInvdBg

You should read PMID: 11137298 for some background. You will be constructing a part derived from the inv gene of Yersinia pseudotuburculosis. The source for your parts is a plasmid, and the sequence is here. You are going to make the prepro-free version of the part. In the sequence file, the prepo is in navy blue. Your part should include the pink region and the lime green region and not the navy blue region.

Due to the large size of this part, you will not sequence every base of your plasmid. You should only sequence with ca998 and G00101 (forward and reverse) and confirm the sequence of the 5' and 3' 500 bp.

Note: The reverse oligo for this part is the same oligo being used for the invasin part in project SBB09 19395. You should coordinate with the person who got that project in designing a single oligo for both parts.

This part encodes a C-terminal display protein

Your displayer part should be of the {<part>} style (no start, no stop). The source sequence for your part likely contains a prepro sequence. You should omit that region of the sequence in designing your part.

You should design your construction file to insert your part into plasmid pBca9495CA-Bca1144#5 using EcoRI and BamHI. The map of this plasmid is here.


ChaI Lectin

 Source: Plasmid pBca9145-Jtk2031

For background you should read PMID: 15039097. ChaI is a lectin (a sugar-binding protein) that binds to polysialic acid which is the outer shell composition of E. coli expressing the K1 capsule. The 5' end of this part is already correctly encoded in a BglBrick vector. The sequence of it is here. The 3' end has a stop codon that you need to remove. So, you'll only need to design one oligo that you can use in addition to this oligo:

 ca998	Forward Sequencing of pSB1A2/pSB1A3
 gtatcacgaggcagaatttcag

This part encodes a passenger protein

Your passenger part should be of the {<part>} style (no start, no stop). There should be NO prepro sequence in your part. If your part is naturally secreted, you should encode only the active peptide. You should design your construction file to insert your part into plasmid pBca9495AK-Bca1144#5 using EcoRI and BamHI. The map of this plasmid is here.