Talk:20.109(S14):Diagnostic primer design (Day2)

From OpenWetWare
Jump to: navigation, search

T/R Section

Sensitivity

Team color Forward (F) primer Reverse (R) primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Red (Final) CAC CAG GTT GAT ACT GCC TGA C CCT ATC CCG AAC CAA ACC CTG bp 1 bp 260 EH, SSU rRNA
Green (Final) ACC AGG TTG ATT CTG CCT GAC TGC CAT CCT TGG ACG TAG TAG bp 2/bp 1 bp 295/bp 257 EH/VC SSU rRNA
Pink (final) ACC AGG TTG ATT CTG CCT GAC TCT CTC ACG CTC CCT CTC C bp1/bp2 bp252/bp290 EH/VC SSU rRna


Specificity

Team Color Forward primer Reverse primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Yellow (FINAL) CCAGGTTGATTCTGCCTGACG CGGAGAGGGAGCCTGAG bp 2 (VC) / bp 3 (EH) bp 250 (VC) / bp 288 (EH) VC/EH, SSU rRNA
Blue (FINAL) GATTCTGCCTGACGTAGATGC CTGCTGGCACCAAACTTGC 10 bp 408 bp E. hellem (AF118143)
Orange (Final) CACCAGGTTGATTCTGCCTGAC GCA AGT CTG TTG CCA GCA (FINAL) 1bp(EH)/1bp(VC) 427bp(EH)/386bp(VC) EH/VC SSU rRNA


W/F Section

Sensitivity

Team color Forward (F) primer Reverse (R) primer Target site (e.g. bp 60), F Target site (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Pink (Final) ACC AGG TTG ATT CTG CCT GAC G TTGCGAGCATACTATCCCCAG bp 1/2 bp 741/768 VC/EH SSU rRNA
Red (Final) ACC AGG TTG ATT CTG CCT GAC ATA TTA CCG CGG CTG CTG bp 1/2 bp 380/421 VC/EH small subunit rRNA
Orange FINAL GTT GAT TCT GCC TGA CGT GG CCT CTC CGG AAC AAA ACC CTG BP 7/8 BP222 VC/EH SSU rRNA
Yellow (FINAL) ACC AGG TTG ATT CTG CCT GAC CGT TGA GTC AAA TTA AGC CGC AC 2 859 EH (SSU rRNA Gene)


Specificity

Team color Forward (F) primer Reverse (R) primer Target site (e.g. bp 60), F Target site (e.g., bp 300), R Is bp # for VC or EH? Which gene?
White (final) CAC CAG GTT GAT TCT GCC TGA C CTA CAC AGC CAG ACT AAA TCA TCG C 1 92 VC; SSU rRNA
Blue (final) CAC CAG GTT GAT TCT GCC TGA C CTG CTG GCA CCA GAC TTG C 1 426 for EH; 386 for VC Both. SSU rRNA
Silver (Final) CAC CAG GTT GAT TCT GCC TGA C TTC ACC ATA GAC ACT ACT GGA GC 1 441 EH
Purple (Final) GTCTGGCTGTGTAGATAACTACG CACTGTGAGACCTCGCATC 102 465 VC
Green (Final) GAG AGA TGC GAG GTC TCA CAG CCA CTG TGT CCA ATG AGC ATG 461 685 (Ends) VC