90
edits
BME103:T930 Group 16 l2: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
→Research and Development
| Line 92: | Line 92: | ||
Reverse primer: 3' CGTCTCTTACTCTATCTCTC 5' | Reverse primer: 3' CGTCTCTTACTCTATCTCTC 5' | ||
Forward primer: 5' AAATATCTGGCTGAGTGTTT 3' | Forward primer: 5' AAATATCTGGCTGAGTGTTT 3' | ||
Cystic fibrosis is caused by a 3 bp deletion that leads to a protein which lacks a critical phenylalanine amino acid in the protein. PCR primers have been developed that can distinguish a normal gene from a mutant gene. With these primers a 154 bp product is produced from a normal individual and a 151 bp product is amplified from DNA of an individual with the disease. The disease allele is complementary which will result in a positive result in Open PCR. However, a regular allele cannot give a positive result because the lost nucleotides will be added back into the primer causing a frameshift mutation of three. Thus, these primers are built 151 bp apart and this shortens the temperature cycles from 30 seconds to 10 seconds. | Cystic fibrosis is caused by a 3 bp deletion that leads to a protein which lacks a critical phenylalanine amino acid in the protein. PCR primers have been developed that can distinguish a normal gene from a mutant gene. With these primers a 154 bp product is produced from a normal individual and a 151 bp product is amplified from DNA of an individual with the disease. The disease allele is complementary which will result in a positive result in Open PCR. However, a regular allele cannot give a positive result because the lost nucleotides will be added back into the primer causing a frameshift mutation of three. Thus, these primers are built 151 bp apart and this shortens the temperature cycles from 30 seconds to 10 seconds. | ||
