BME103:T930 Group 16 l2: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 98: Line 98:
<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP --->
<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP --->
[[Image:Protein Misfolding.jpg]]<br>
[[Image:Protein Misfolding.jpg]]<br>
[[Image:Cystic Fibrosis.jpg]]<br>
[[Image:Cystic Fibrosis.jpg|200px]]<br>
[[Image:CF Pic.jpg]]<br>
[[Image:CF Pic.jpg|200px]]<br>
[[Image:CF Location.jpg]]<br>
[[Image:CF Location.jpg|200px]]<br>


<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
|}
|}

Revision as of 19:08, 25 November 2012

BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help

OUR TEAM

Name: Student
Role(s)
Name: Student
Role(s)
Name: Student
Role(s)
Name: Student
Role(s)
Name: Student
Role(s)

LAB 2 WRITE-UP

Thermal Cycler Engineering

Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.


System Design


Key Features
Four solar panels will be added to the top of the PCR machine. This will allow the PCR machine to run on its own without having to plug it into an outlet; resulting in it being environmentally friendly while still being able to detect different diseases in DNA samples. A crystalized monitor will also be placed on the PCR's side panel. The monitor will display the current status of the sample that is being used, along with the amount of time left in the process. Eliminating the necessity of a computer during this process.


Instructions
1) Take the pre-cut solar panels and insert them into the modified top of the open PCR machine.
2) Once inserted, let these solar panels charge under the light.
3) To insert the crystalized monitor, screw it into the modified side of the open PCR machine. Before placing the monitor into the side of the PCR machine, make sure to connect the correct wires (directed by color) together in order for the monitor to operate.




Protocols

Materials


PCR Protocol
Before starting the experiment be sure that the solar panels on the PCR machine have been charged. To prepare the DNA samples for the PCR, label the DNA test tubes with the patients name and replication number or label it in some way so that you will be able to distinguish between the patient sample and which replication it is (for example P1 R1 for patient one replication one). Put a corresponding label on the tubes containing the reaction mix that will be placed into the actual PCR. After you have labeled all of your patient samples and your positive and negative control, you are ready to add the samples to the PCR reaction mix. The reaction mix includes: Taq DNA polymerase, forward primer, reverse primer, MgCl2 and dNTP's. 100 mL of the reaction mix should be placed in the tubes. Using a different transfer pipette each time, transfer your DNA samples, and positive and negative controls to separate tubes of the reaction mix.


DNA Measurement Protocol

Research and Development

Background on Disease Markers

Group 16 decided to investigate cystic fibrosis, a disease that is caused by mutations in a specific gene on the seventh chromosome, and is then passed down through families as a recessive trait. In this disease, mucus accumulates inside the lungs, digestive tract, and other cavities in the body. This life-threatening disease is the most common chronic lung disease to affect children and is often diagnosable by the age of two. However, weaker strains can go undetected until early adulthood. The effects of this disease, however, have been mediated through the use of treatments that can postpone some of the changes that occur in the lungs. Half of the patients with cystic fibrosis live past 28 years, and patients who only have mucus buildup in the digestive tract are even better off. Gene therapy holds great promise for treating cystic fibrosis. The marker associated with cystic fibrosis is a two nucleotide deletion and has identity rs200007348. This two nucleotide deletion is due to an adenine-guanine swap that occurs in the codon TGG. A codon is a genetic code involved in the RNA process that impacts protein translation. When the TGG undergoes the adenine guanine swap, it becomes TGA which codes for the stop codon, ending protein translation. This SNP heightens susceptibility to cystic fibrosis, a disease with the frequency 1 out of 2000 in Europe and 1 out of 3500 in the United States


Primer Design

Reverse primer: 3' CGTCTCTTACTCTATCTCTC 5' Forward primer: 5' AAATATCTGGCTGAGTGTTT 3' Cystic fibrosis is caused by a 3 bp deletion that leads to a protein which lacks a critical phenylalanine amino acid in the protein. PCR primers have been developed that can distinguish a normal gene from a mutant gene. With these primers a 154 bp product is produced from a normal individual and a 151 bp product is amplified from DNA of an individual with the disease. The disease allele is complementary which will result in a positive result in Open PCR. However, a regular allele cannot give a positive result because the lost nucleotides will be added back into the primer causing a frameshift mutation of three. Thus, these primers are built 151 bp apart and this shortens the temperature cycles from 30 seconds to 10 seconds.


Illustration