1,897
edits
Kafatos:dsRNA Production by PCR: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
no edit summary
No edit summary |
No edit summary |
||
| Line 3: | Line 3: | ||
== Preparation of dsRNA from PCR products (single tube synthesis) == | == Preparation of dsRNA from PCR products (single tube synthesis) == | ||
=== PCR === | === PCR === | ||
• Design PCR primers for a 200 – 600 bp section of the gene of interest. The targeted region should not be located in high homology regions, and preferably located as close to the 3’ prime end of the gene as possible. Use this [http://www.dkfz.de/signaling/ernai/ernai_prime.html website] to assist you.<BR> | • Design PCR primers for a 200 – 600 bp section of the gene of interest. The targeted region should not be located in high homology regions, and preferably located as close to the 3’ prime end of the gene as possible. Tail both your PCR primers with the T7 promoter sequence GAATTAATACGACTCACTATAGGGAGA at their 5’ end. Use this [http://www.dkfz.de/signaling/ernai/ernai_prime.html website] to assist you.<BR> | ||
• | • Standard purification (desalt) of the primers is acceptable.<BR> | ||
• Amplify the fragment by PCR using the following concentrations:<BR> | • Amplify the fragment by PCR using the following concentrations:<BR> | ||
10x PCR Buffer 5 μl | 10x PCR Buffer 5 μl | ||
