71
edits
User:Miroslav Gasparek: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
→Contact Info
| Line 1: | Line 1: | ||
== | ==Summary== | ||
[[Image: MiroslavGasparek.jpg|thumb|right| | [[Image: MiroslavGasparek.jpg|thumb|right|ACACTGCACTGTTGAATCACTGTAAGCGTCACTTGAGAGACTCACCTATCG]] | ||
* '''Miroslav Gasparek''' | * '''Miroslav Gasparek''' | ||
* | * PhD student at the University of Oxford (since Oct 2019) | ||
* Former Visiting Undergraduate Intern at Endy Lab, Stanford University | * MEng Biomedical Engineering at Imperial College London (Oct 2015- Jun 2019) | ||
* Former Visiting Undergraduate Student at Murray Lab, California Institute of Technology | * Former Visiting Undergraduate Intern at Endy Lab, Stanford University (Jul 2018 - Aug 2018) | ||
* Former Undergraduate Research Assistant at Tanaka Group, Imperial College London | * Former Visiting Undergraduate Student at Murray Lab, California Institute of Technology (Jul 2017 - Oct 2017) | ||
* Former Undergraduate Research Assistant at Tanaka Group, Imperial College London (Jun 2016 - Aug 2016) | |||
E-mail: miroslav. | E-mail: miroslav.gasparek@eng.ox.ac.uk <br /> | ||
[[Special:Emailuser/Miroslav Gasparek|Email me through OpenWetWare]] <br /> | [[Special:Emailuser/Miroslav Gasparek|Email me through OpenWetWare]] <br /> | ||
GitHub: [https://github.com/ | GitHub: [https://github.com/miroslavgasparek Miroslav Gasparek] <br /> | ||
Twitter: [https://twitter.com/MiroGasparek @MiroGasparek] <br /> | Twitter: [https://twitter.com/MiroGasparek @MiroGasparek] <br /> | ||
Personal Website: [https://www.miroslavgasparek.com/ www.miroslavgasparek.com] <br /> | |||
I am a PhD student of Engineering Science at the University of Oxford, where I focus on applications of Control Theory in Synthetic Biology under the supervision of [http://sysos.eng.ox.ac.uk/wiki/index.php/User:Antonis Professor Antonis Papachristodoulou] and [https://steel.ac/people/ Professor Harrison Steel]. In my research, I am combining mathematical and computational methods to design complex biomolecular feedback systems at both cellular and population levels. I am also fascinated by [https://www.buildacell.org/ synthetic cells]. | |||
<br /> | |||
I received MEng Biomedical Engineering at Imperial College London in 2019, where I mainly focused on using computational modelling of optimal eczema treatment using control theory and reinforcement learning under the supervision of Dr Reiko Tanaka. In the summer of 2018, I was a visiting researcher in the Endy Lab at Stanford University, where I worked on building an assay for evaluating protein-protein interactions in the minimal bacterial genome to elucidate the functions of essential genes. In 2017, I was a visiting researcher in Murray Lab at Caltech, where I worked on modelling interconnected biomolecular subsystems in the context of a synthetic cell. | |||
<br /> | <br /> | ||
<br /> | <br /> | ||
