Silver: Commonly Used Primers

From OpenWetWare
Jump to: navigation, search

Commonly Used Primers

  • Sequencing primers for Biobrick & Biofusion vectors:
    • V0100/V0120 forward sequencing primer: 5' GGGTTTTCCCAGTCACGACG 3'
    • V0100/V0120 reverse sequencing primer: 5' TGTGGAATTGTGAGCGGATAACA 3'
    • V0002 forward sequencing primer: 5' tttctggaattcgcggcc 3'
    • V0002 reverse sequencing primer: 5' gccggactgcagcggcc 3'
  • Primers that sequence regions between the Biobrick ends
    • upstream of a Kozak region (K0001): 5' TCTAGTCTCCATGGTGGCGG 3'
    • downstream of a Kozak region (K0001): 5' CCGCCACCATGGAGACTAGA 3'
    • upstream of the ADH1 terminator (L0100): 5' CCTGAGAAAGCAACCTGACCTACAG 3'
    • downstream of midpoint btwn yeast-codon optimized YFP/mCherryx2 (Z0035 or Z0037): 5' GGTACCGCAACTAGAGCAACTAGC 3'
    • upstream of midpoint btwn yeast-codon optimized YFP/mCherryx2(Z0035 or Z0037): 5' GCTAGTTGCTCTAGTTGCGGTACC 3'