Sbb14-Karim Merchant

From OpenWetWare
Jump to: navigation, search


Lab Notebook BioE 140L Spring 2014

Karim R. Merchant 01:50, 7 February 2014 (EST)

Lab Notebook created

January 30th and February 4th Golden Gate Assembly

Golden Gate Assembly Demo

Combining 5 "parts" into 1 "device". Digestion and Ligation will happen in same step.

Colonies: Green (want). White (something mis-ligated/star activity). Red (if RFP wasn't chopped out during digestion).

Did Transformation, and plating.

Results looked good- plenty of green colonies. 2 white colonies, and a few red colonies as well.

February 6th

Karim R. Merchant

00:11, 18 February 2014 (EST)

Our group members were assigned. I'm in Group 4 with: Chris Coates, Kelvin Li, Christy Truong, and Tae Won Chung. Our project is to make a cohort of aminoacyl tRNA synthetases for a thermophilic organism.

Job for next class: Find suitable themophilic bacteria to obtain tRNA synthetase genes from. Ex/ Thermus Thermophilus. Find papers that cite that organism's aaRSs to be suitable in e. coli. Use Pubmed for genome searches, and use multiple sequence alignment to match up the genes for all 20 synthetases to the ones in e. coli.

February 13th

Karim R. Merchant 00:33, 18 February 2014 (EST)

We had a debate during class discussing which thermophilic organisms to use to obtain aaRS genes which could be compatible with e. coli bacteria. Ended up deciding on 2: Thermus thermophilus and Thermotoga maritima. The Professor assigned teams 1 and 2 to work on Thermus thermophilus and teams 3 and 4 to work on Thermotoga maritima. Also, teams 1 and 3 will work on cloning the following amino acids: A C D E F G H I K L. Teams 2 and 4 will clone: M N P Q R S T V W Y. Within my team, I was assigned to clone W (Trp) and Y (Tyr). Both of my amino acids are single polypeptides, so only 1 gene needs to be cloned (unlike PheRS).

Thermotoga maritima: ATCC# 27634D-5 and Accession # AE000512.

Our backbone plasmid will be pBAD myc/his A. It can be obtained from invitrogen. We are to insert genes between NcoI and EcoRI. Designing primers: need 20 bp of perfect homology, and then add restriction sites/ extra bp at termini.

Process:

PCR

Gel cleanup

Digest PCR insert and plasmid (also phosphorylate)

Cleanup

Ligate

Transform

Rescue

Plate

February 19th

Karim R. Merchant 00:11, 20 February 2014 (EST)

I planned my construction files to insert TyrRS and TrpRS Thermotoga Maritima genes into the pBADmychisA plasmid. The TyrRS gene was slightly convoluted as it contained a NcoI internal restriction site. I used SOEing to get rid of it. My construction files are below.


Construction file for TrpRS

PCR TrpRS-Fwd/TrpRS-Rv on Thermotoga Maritima genome  (1008 bp, pcrpdt)

Digest pcrpdt                         (NcoI/EcoRI, 992+10+6, L, pcrdig)

Digest pBAD-myc-his-A                 (NcoI/EcoRI, 4053+41, L, vectdig)

Ligate pcrdig and vectdig             (pBAD-TrpRS)

--

>TrpRS-Fwd	Forward primer for PCR of TrpRS from Thermotoga Maritima  

ccagtCCATGGcaAGAATACTGAGCGGCATGAG

>TrpRS-Rv	Reverse primer for PCR of TrpRS from Thermotoga Maritima 

ccagtGAATTCTCAGAACATCAGGTTCATG

>TrpRS gene DNA sequence in Thermotoga Maritima genome

TTGAGAATACTGAGCGGCATGAGACCTACCGGAAAACTCCATATAGGTCATCTCGTGGGAGCTCTGGAAA
ACTGGGTGAAGCTTCAGGAAGAAGGAAACGAATGTTTCTACTTTGTCGCGGATTGGCACGCTTTGACCAC
CCACTACGACGATGTTTCGAAGCTCAAAGAATACACCCGCGACCTGGTGAGGGGATTTCTCGCCTGTGGA
ATAGATCCTGAAAAGTCCGTGATTTTTGTTCAGTCTGGTGTCAAAGAGCACGCTGAGCTTGCACTGCTTT
TCAGCATGATCGTTTCTGTTTCACGTCTCGAGAGGGTTCCCACTTACAAAGAGATAAAAAGTGAGCTGAA
CTACAAAGATCTTTCCACGGCTGGTTTTCTCATCTATCCCGTTCTTCAGGCAGCCGATATTTTGATCTAC
AAAGCTGAAGGAGTACCAGTCGGTGAAGATCAGGTTTACCACATAGAACTCACGAGGGAGATCGCCAGGC
GTTTTAACTATCTCTACGATGAAGTCTTTCCAGAACCAGAAGCAATTCTGTCTCGGGTTCCAAAGCTTCC
AGGAACGGACGGCCGAAAGATGAGCAAAAGCTATGGGAACATAATAAACCTAGAAATCTCGGAAAAAGAA
CTGGAACAGACGATACTGAGGATGATGACCGATCCAGCGAGGGTGAGAAGGAGCGACCCTGGAAATCCGG
AGAACTGCCCCGTATGGAAATACCACCAGGCGTTCGACATCAGTGAAGAAGAGAGCAAATGGGTATGGGA
AGGCTGTACAACGGCCAGCATCGGCTGTGTTGATTGTAAGAAGTTGCTGTTGAAGAATATGAAACGAAAA
TTGGCACCGATCTGGGAGAACTTCAGAAAAATAGACGAAGATCCACACTACGTGGACGACGTTATAATGG
AAGGGACGAAGAAGGCCAGAGAAGTGGCTGCTAAAACGATGGAAGAAGTGAGAAGGGCCATGAACCTGAT
GTTCTGA

>pBAD-myc-his-A  
AAGAAACCAATTGTCCATATTGCATCAGACATTGCCGTCACTGCGTCTTTTACTGGCTCTTCTCGCTAACCAAACCGGTAACCCCGCTTATTAAAAGCATTCTGTAACAAAGCGGGACCAAAGCCATGACAAAAACGCGTAACAAAAGTGTCTATAATCACGGCAGAAAAGTCCACATTGATTATTTGCACGGCGTCACACTTTGCTATGCCATAGCATTTTTATCCATAAGATTAGCGGATCCTACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATACCCGTTTTTTGGGCTAACAGGAGGAATTAACCATGGATCCGAGCTCGAGATCTGCAGCTGGTACCATATGGGAATTCGAAGCTTGGGCCCGAACAAAAACTCATCTCAGAAGAGGATCTGAATAGCGCCGTCGACCATCATCATCATCATCATTGAGTTTAAACGGTCTCCAGCTTGGCTGTTTTGGCGGATGAGAGAAGATTTTCAGCCTGATACAGATTAAATCAGAACGCAGAAGCGGTCTGATAAAACAGAATTTGCCTGGCGGCAGTAGCGCGGTGGTCCCACCTGACCCCATGCCGAACTCAGAAGTGAAACGCCGTAGCGCCGATGGTAGTGTGGGGTCTCCCCATGCGAGAGTAGGGAACTGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGGGAGCGGATTTGAACGTTGCGAAGCAACGGCCCGGAGGGTGGCGGGCAGGACGCCCGCCATAAACTGCCAGGCATCAAATTAAGCAGAAGGCCATCCTGACGGATGGCCTTTTTGCGTTTCTACAAACTCTTTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTATACACTCCGCTATCGCTACGTGACTGGGTCATGGCTGCGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGGCAGCAGATCAATTCGCGCGCGAAGGCGAAGCGGCATGCATAATGTGCCTGTCAAATGGACGAAGCAGGGATTCTGCAAACCCTATGCTACTCCGTCAAGCCGTCAATTGTCTGATTCGTTACCAATTATGACAACTTGACGGCTACATCATTCACTTTTTCTTCACAACCGGCACGGAACTCGCTCGGGCTGGCCCCGGTGCATTTTTTAAATACCCGCGAGAAATAGAGTTGATCGTCAAAACCAACATTGCGACCGACGGTGGCGATAGGCATCCGGGTGGTGCTCAAAAGCAGCTTCGCCTGGCTGATACGTTGGTCCTCGCGCCAGCTTAAGACGCTAATCCCTAACTGCTGGCGGAAAAGATGTGACAGACGCGACGGCGACAAGCAAACATGCTGTGCGACGCTGGCGATATCAAAATTGCTGTCTGCCAGGTGATCGCTGATGTACTGACAAGCCTCGCGTACCCGATTATCCATCGGTGGATGGAGCGACTCGTTAATCGCTTCCATGCGCCGCAGTAACAATTGCTCAAGCAGATTTATCGCCAGCAGCTCCGAATAGCGCCCTTCCCCTTGCCCGGCGTTAATGATTTGCCCAAACAGGTCGCTGAAATGCGGCTGGTGCGCTTCATCCGGGCGAAAGAACCCCGTATTGGCAAATATTGACGGCCAGTTAAGCCATTCATGCCAGTAGGCGCGCGGACGAAAGTAAACCCACTGGTGATACCATTCGCGAGCCTCCGGATGACGACCGTAGTGATGAATCTCTCCTGGCGGGAACAGCAAAATATCACCCGGTCGGCAAACAAATTCTCGTCCCTGATTTTTCACCACCCCCTGACCGCGAATGGTGAGATTGAGAATATAACCTTTCATTCCCAGCGGTCGGTCGATAAAAAAATCGAGATAACCGTTGGCCTCAATCGGCGTTAAACCCGCCACCAGATGGGCATTAAACGAGTATCCCGGCAGCAGGGGATCATTTTGCGCTTCAGCCATACTTTTCATACTCCCGCCATTCAGAG


-------------------------------------------------------------------------------------------------------------------------
Construction file for TyrRS

PCR TyrRS-Fwd/TyrRS-Rv on Thermotoga Maritima  (1248 bp, pcrpdt)

PCR TyrRS-Fwd/NcoI-SOEing-Rv on pcrpdt  (922 bp, A)

PCR NcoI-SOEing-Fwd/TyrRS-Rv on pcrpdt  (352bp, B)

PCR TyrRS-Fwd/TyrRS-Rv on A+B		(1248 bp, newpcrpdt)

Digest newpcrpdt                        (NcoI/EcoRI, 1232+10+6, L, pcrdig)

Digest pBAD-myc-his-A                   (NcoI/EcoRI, 4053+41, L, vectdig)

Ligate pcrdig and vectdig               (pBAD-TyrRS)

--

>TyrRS-Fwd	Forward primer for PCR of TyrRS from Thermotoga Maritima  

ccagtCCATGGcaacgccggaggaacaggtg

>TyrRS-Rv	Reverse primer for PCR of TyrRS from Thermotoga Maritima 

ccagtGAATTCcaaaggaaattcaagagttttc

>NcoI-SOEing-Fwd	Forward primer for SOEing PCR of TyrRS from Thermotoga Maritima 
 
cgcgcttcttCCAcGGtgaagaaaac

>NcoI-SOEing-Rv 	Reverse primer for SOEing PCR of TyrRS from Thermotoga Maritima 

gttttcttcaCCgTGGaagaagcgcg

>TyrRS gene DNA sequence in Thermotoga Maritima genome 

ATGACGCCGGAGGAACAGGTGAAAATTCTCAAAAGAAACGTTGTTGACCTCATAAGTGAAGAAGAACTCCTCGACAGAATAAAAAGAAAAGGAAAACTCCGCGTGAAACTCGGTGTGGATCCCTCAAGGCCCGATTTGCATCTGGGTCACGCGGTCGTTCTGAGGAAGTTGAGAGAATTTCAGGATCTCGGTCACACGGTCGTTCTGATCATAGGAGACTTCACCGCACGTATTGGTGATCCCTCCGGAAGAAACGAAACACGCCCCATGCTGACCAAAGAAGAGGTTCTGGAGAACGCAAAGACCTATCAGGAGCAGGCCTTCAAAATACTGGATCCCAAAAGAACGGAACTTCGCTTCAACGGTGAGTGGCTCGACAGGATGACCTTCGCAGATGTGATCATTCTGGCTTCGAAGTACACGGTTGCGAGGATGCTCGAGAGAGACGATTTCGCAAAGAGATTCAAAGAAGGCATTCCCATTGCCATATCAGAGTTTCTGTATCCGCTCGCACAGGCCTACGATTCCGTTGCCATCCAGTCAGATGTGGAACTCGGCGGAACGGATCAGCTTTTCAACCTCCTTGTGGGAAGGAAGATACAGGAAGAATACGGTCAAGAGCCCCAGATCGTCATGACGATGCCGATCATCGAGGGAACAGACGGAAAATTGAAGATGAGCAAAAGCTACGGAAACTACATCGCTTTCAACGATCCGCCCGAGGAGATGTACGGCAAACTCATGTCCATACCTGATGAACTCATCATAAAATACATGCGCCTTCTCACGGACATCCCAGAAGAACGGATCGAAGAGTACGAAAGAAAGATGAAGGAAAAAACGATCAATCCACGAGACGTGAAGATGGTTCTCGCGTACGAGATAACGCGCTTCTTCCATGGTGAAGAAAACGCAAAGAAGGCCCAGGAACACTTCGTGAAAGTCTTTCAAAAGAAAGAAATTCCTGACGAGATGCCGGTCGTTGAGATTTCTCAGGAGAAGAACATCGTGGATCTCCTCGTGGAGATAGGAGCTGCATCCAGCAAAAGTGAGGCTAAAAGACTCGTTTCTCAAGGTGGAGTGTACATCGACGGAGAGAGGATAGAGGACATAAAATTCACTGTAGAACCTGATGGAGAGCGAGTTTTGAGAGTTGGAAAGAGGAAGTTCTACAGAATATCAGGTGGAGAGACAAAAAAACTTTAGAAAACTCTTGAATTTCCTTTG

>pBAD-myc-his-A  
AAGAAACCAATTGTCCATATTGCATCAGACATTGCCGTCACTGCGTCTTTTACTGGCTCTTCTCGCTAACCAAACCGGTAACCCCGCTTATTAAAAGCATTCTGTAACAAAGCGGGACCAAAGCCATGACAAAAACGCGTAACAAAAGTGTCTATAATCACGGCAGAAAAGTCCACATTGATTATTTGCACGGCGTCACACTTTGCTATGCCATAGCATTTTTATCCATAAGATTAGCGGATCCTACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATACCCGTTTTTTGGGCTAACAGGAGGAATTAACCATGGATCCGAGCTCGAGATCTGCAGCTGGTACCATATGGGAATTCGAAGCTTGGGCCCGAACAAAAACTCATCTCAGAAGAGGATCTGAATAGCGCCGTCGACCATCATCATCATCATCATTGAGTTTAAACGGTCTCCAGCTTGGCTGTTTTGGCGGATGAGAGAAGATTTTCAGCCTGATACAGATTAAATCAGAACGCAGAAGCGGTCTGATAAAACAGAATTTGCCTGGCGGCAGTAGCGCGGTGGTCCCACCTGACCCCATGCCGAACTCAGAAGTGAAACGCCGTAGCGCCGATGGTAGTGTGGGGTCTCCCCATGCGAGAGTAGGGAACTGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGGGAGCGGATTTGAACGTTGCGAAGCAACGGCCCGGAGGGTGGCGGGCAGGACGCCCGCCATAAACTGCCAGGCATCAAATTAAGCAGAAGGCCATCCTGACGGATGGCCTTTTTGCGTTTCTACAAACTCTTTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTATACACTCCGCTATCGCTACGTGACTGGGTCATGGCTGCGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGGCAGCAGATCAATTCGCGCGCGAAGGCGAAGCGGCATGCATAATGTGCCTGTCAAATGGACGAAGCAGGGATTCTGCAAACCCTATGCTACTCCGTCAAGCCGTCAATTGTCTGATTCGTTACCAATTATGACAACTTGACGGCTACATCATTCACTTTTTCTTCACAACCGGCACGGAACTCGCTCGGGCTGGCCCCGGTGCATTTTTTAAATACCCGCGAGAAATAGAGTTGATCGTCAAAACCAACATTGCGACCGACGGTGGCGATAGGCATCCGGGTGGTGCTCAAAAGCAGCTTCGCCTGGCTGATACGTTGGTCCTCGCGCCAGCTTAAGACGCTAATCCCTAACTGCTGGCGGAAAAGATGTGACAGACGCGACGGCGACAAGCAAACATGCTGTGCGACGCTGGCGATATCAAAATTGCTGTCTGCCAGGTGATCGCTGATGTACTGACAAGCCTCGCGTACCCGATTATCCATCGGTGGATGGAGCGACTCGTTAATCGCTTCCATGCGCCGCAGTAACAATTGCTCAAGCAGATTTATCGCCAGCAGCTCCGAATAGCGCCCTTCCCCTTGCCCGGCGTTAATGATTTGCCCAAACAGGTCGCTGAAATGCGGCTGGTGCGCTTCATCCGGGCGAAAGAACCCCGTATTGGCAAATATTGACGGCCAGTTAAGCCATTCATGCCAGTAGGCGCGCGGACGAAAGTAAACCCACTGGTGATACCATTCGCGAGCCTCCGGATGACGACCGTAGTGATGAATCTCTCCTGGCGGGAACAGCAAAATATCACCCGGTCGGCAAACAAATTCTCGTCCCTGATTTTTCACCACCCCCTGACCGCGAATGGTGAGATTGAGAATATAACCTTTCATTCCCAGCGGTCGGTCGATAAAAAAATCGAGATAACCGTTGGCCTCAATCGGCGTTAAACCCGCCACCAGATGGGCATTAAACGAGTATCCCGGCAGCAGGGGATCATTTTGCGCTTCAGCCATACTTTTCATACTCCCGCCATTCAGAG

February 23rd

Karim R. Merchant 01:47, 24 February 2014 (EST)

Today I spent the day checking my group's primers and making necessary changes, along with making a compilation file with all the primers our group needs listed. A list of changes I made can be found in the following text, which is a copy of the email I sent to my group.

"Hey guys,

I have attached a complete primer list. Please check.

Chris- I redid your ArgRS and SerRS primers to have BsaI on both ends. This way you don't have to do a double digest, and also don't have to do SOEing, as there are no BsaI sites in ArgRS (or SerRS).

Tae Won- I did your GlnRS SOEing primers so they don't change your amino acid sequence.

Kelvin- For SOEing, the internal forward and reverse primers have to be compliments to each other. I redid your ThrRS internal SOEing primers. Also, I changed the "extra sequence" that comes in front of the restriction site for Valyl External Forward to no longer have an ATG in it. It shouldn't matter of course, as it's supposed to be cut out. Just a precaution.

Christy- your second oligo was the reverse compliment of what the primer should be so I switched it for you.

Everyone needs to check that their primers work and don't mess up the amino acid sequence for their respective protein, other than perhaps adding the extra Alanine after the initial Methionine. Also, please update your construction files with these primers/processes. Some proteins have shifted from SOEing to using BsaI. Please reply back to this email ASAP to confirm primers work, so I can send this file to Professor Anderson."

The compilation file I made with all the primers listed is attached: Media:Group4Primers.docx

February 25th

Karim R. Merchant 00:38, 26 February 2014 (EST)

Today we checked and finalized our primers during lab. They are attached: Media:Group_4_Primers.xlsx

I also updated my construction file for TyrRS without SOEing, and with BsaI sites:

Construction file for TyrRS

PCR TyrRS BsaI NcoI Fwd/TyrRS BsaI EcoRI Rv on Thermotoga Maritima  (1260 bp, pcrpdt)
Digest pcrpdt                        	(BsaI, 1232+16+12, L, pcrdig)
Digest pBAD-myc-his-A                   (NcoI/EcoRI, 4053+41, L, vectdig)
Ligate pcrdig and vectdig               (pBAD-TyrRS)
-----------------------------------------
>TyrRS BsaI NcoI Fwd	Forward primer for PCR of TyrRS from Thermotoga Maritima  
ccagtGGTCTCCCATGGcaacgccggaggaacaggtg
>TyrRS BsaI EcoRI Rv	Reverse primer for PCR of TyrRS from Thermotoga Maritima 
ccagtGGTCTCGAATTCcaaaggaaattcaagagttttc
>TyrRS gene DNA sequence in Thermotoga Maritima genome
ATGACGCCGGAGGAACAGGTGAAAATTCTCAAAAGAAACGTTGTTGACCTCATAAGTGAAGAAGAACTCCTCGACAGAATAAAAAGAAAAGGAAAACTCCGCGTG
AAACTCGGTGTGGATCCCTCAAGGCCCGATTTGCATCTGGGTCACGCGGTCGTTCTGAGGAAGTTGAGAGAATTTCAGGATCTCGGTCACACGGTCGTTCTGATC
ATAGGAGACTTCACCGCACGTATTGGTGATCCCTCCGGAAGAAACGAAACACGCCCCATGCTGACCAAAGAAGAGGTTCTGGAGAACGCAAAGACCTATCAGGAG
CAGGCCTTCAAAATACTGGATCCCAAAAGAACGGAACTTCGCTTCAACGGTGAGTGGCTCGACAGGATGACCTTCGCAGATGTGATCATTCTGGCTTCGAAGTAC
ACGGTTGCGAGGATGCTCGAGAGAGACGATTTCGCAAAGAGATTCAAAGAAGGCATTCCCATTGCCATATCAGAGTTTCTGTATCCGCTCGCACAGGCCTACGAT
TCCGTTGCCATCCAGTCAGATGTGGAACTCGGCGGAACGGATCAGCTTTTCAACCTCCTTGTGGGAAGGAAGATACAGGAAGAATACGGTCAAGAGCCCCAGATC
GTCATGACGATGCCGATCATCGAGGGAACAGACGGAAAATTGAAGATGAGCAAAAGCTACGGAAACTACATCGCTTTCAACGATCCGCCCGAGGAGATGTACGGC
AAACTCATGTCCATACCTGATGAACTCATCATAAAATACATGCGCCTTCTCACGGACATCCCAGAAGAACGGATCGAAGAGTACGAAAGAAAGATGAAGGAAAAA
ACGATCAATCCACGAGACGTGAAGATGGTTCTCGCGTACGAGATAACGCGCTTCTTCCATGGTGAAGAAAACGCAAAGAAGGCCCAGGAACACTTCGTGAAAGTC
TTTCAAAAGAAAGAAATTCCTGACGAGATGCCGGTCGTTGAGATTTCTCAGGAGAAGAACATCGTGGATCTCCTCGTGGAGATAGGAGCTGCATCCAGCAAAAGT
GAGGCTAAAAGACTCGTTTCTCAAGGTGGAGTGTACATCGACGGAGAGAGGATAGAGGACATAAAATTCACTGTAGAACCTGATGGAGAGCGAGTTTTGAGAGTT
GGAAAGAGGAAGTTCTACAGAATATCAGGTGGAGAGACAAAAAAACTTTAGAAAACTCTTGAATTTCCTTTG

>pBAD-myc-his-A  
AAGAAACCAATTGTCCATATTGCATCAGACATTGCCGTCACTGCGTCTTTTACTGGCTCTTCTCGCTAACCAAACCGGTAACCCCGCTTATTAAAAGCATTCTGTAACAAAGCGGGACCAAAGCCATGACAAAAACGCGTAACAAAAGTGTCTATAATCACGGCAGAAAAGTCCACATTGATTATTTGCACGGCGTCACACTTTGCTATGCCATAGCATTTTTATCCATAAGATTAGCGGATCCTACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATACCCGTTTTTTGGGCTAACAGGAGGAATTAACCATGGATCCGAGCTCGAGATCTGCAGCTGGTACCATATGGGAATTCGAAGCTTGGGCCCGAACAAAAACTCATCTCAGAAGAGGATCTGAATAGCGCCGTCGACCATCATCATCATCATCATTGAGTTTAAACGGTCTCCAGCTTGGCTGTTTTGGCGGATGAGAGAAGATTTTCAGCCTGATACAGATTAAATCAGAACGCAGAAGCGGTCTGATAAAACAGAATTTGCCTGGCGGCAGTAGCGCGGTGGTCCCACCTGACCCCATGCCGAACTCAGAAGTGAAACGCCGTAGCGCCGATGGTAGTGTGGGGTCTCCCCATGCGAGAGTAGGGAACTGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGGGAGCGGATTTGAACGTTGCGAAGCAACGGCCCGGAGGGTGGCGGGCAGGACGCCCGCCATAAACTGCCAGGCATCAAATTAAGCAGAAGGCCATCCTGACGGATGGCCTTTTTGCGTTTCTACAAACTCTTTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTATACACTCCGCTATCGCTACGTGACTGGGTCATGGCTGCGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGGCAGCAGATCAATTCGCGCGCGAAGGCGAAGCGGCATGCATAATGTGCCTGTCAAATGGACGAAGCAGGGATTCTGCAAACCCTATGCTACTCCGTCAAGCCGTCAATTGTCTGATTCGTTACCAATTATGACAACTTGACGGCTACATCATTCACTTTTTCTTCACAACCGGCACGGAACTCGCTCGGGCTGGCCCCGGTGCATTTTTTAAATACCCGCGAGAAATAGAGTTGATCGTCAAAACCAACATTGCGACCGACGGTGGCGATAGGCATCCGGGTGGTGCTCAAAAGCAGCTTCGCCTGGCTGATACGTTGGTCCTCGCGCCAGCTTAAGACGCTAATCCCTAACTGCTGGCGGAAAAGATGTGACAGACGCGACGGCGACAAGCAAACATGCTGTGCGACGCTGGCGATATCAAAATTGCTGTCTGCCAGGTGATCGCTGATGTACTGACAAGCCTCGCGTACCCGATTATCCATCGGTGGATGGAGCGACTCGTTAATCGCTTCCATGCGCCGCAGTAACAATTGCTCAAGCAGATTTATCGCCAGCAGCTCCGAATAGCGCCCTTCCCCTTGCCCGGCGTTAATGATTTGCCCAAACAGGTCGCTGAAATGCGGCTGGTGCGCTTCATCCGGGCGAAAGAACCCCGTATTGGCAAATATTGACGGCCAGTTAAGCCATTCATGCCAGTAGGCGCGCGGACGAAAGTAAACCCACTGGTGATACCATTCGCGAGCCTCCGGATGACGACCGTAGTGATGAATCTCTCCTGGCGGGAACAGCAAAATATCACCCGGTCGGCAAACAAATTCTCGTCCCTGATTTTTCACCACCCCCTGACCGCGAATGGTGAGATTGAGAATATAACCTTTCATTCCCAGCGGTCGGTCGATAAAAAAATCGAGATAACCGTTGGCCTCAATCGGCGTTAAACCCGCCACCAGATGGGCATTAAACGAGTATCCCGGCAGCAGGGGATCATTTTGCGCTTCAGCCATACTTTTCATACTCCCGCCATTCAGAG

February 27th

Karim R. Merchant 15:34, 28 February 2014 (EST)

Today we all did minipreps to collect plasmid pBAD-myc-his-A from e. coli cells. I did 2x 1.5 mL cell juice minipreps. The protocol can be found here: JCA Protocols

March 4th

Karim R. Merchant 02:14, 5 March 2014 (EST)

Today I ran my first PCRs to amplify the genes TrpRS and TyrRS out of the Thermotoga Maritima genome. First I diluted the stock primers to 100 uM and then made a dilution of that to 10 uM. For TrpRS, my primers were TrpRS NcoI Fwd/TrpRS EcoRI Rv, and for TyrRS my primers were TyrRS BsaI NcoI Fwd/TyrRS BsaI EcoRI Rv. Both PCRs were below 2 kilobases in length.

For both PCRs, I followed the following mixture setup:

24 uL ddH2O

3.3 uL Expand Buffer 2

3.3 uL dNTP 2mM in each stock

1 uL 10 uM primer 1

1 uL 10 uM primer 2

0.5 uL genomic DNA

0.5 uL Expand Polymerase 1

=33.6 uL total

The Thermocycler set up was:

1. 94°C for 2 min

2. 94°C for 15 sec

3. 55°C for 30 sec (should be lower than Tm of all primers)

4. 72°C for 2 min (1 min/kilobase)

5. Go to step 2 30x

6. 72°C for 7 min

7. 16°C for ever.

Next: PCR clean ups are on Thursday March 6th along with analytical gels.

March 6th

Karim R. Merchant 20:22, 9 March 2014 (EDT)

Today we ran an analytical agarose gel to see the sizes of our group's PCR products. The agarose gel was made by mixing 1g of agarose powder in 1mL of 1x TAE buffer, and microwaved until it reached a boiling state. Next, 10 uL of 10,000x Gel dye was added. The samples were prepared by mixing 2 uL of the PCR product with 6 uL of ddH2O along with 1 uL of DNA loading dye. The first lane of the gel was loaded with 5 uL of Quick Load 2-Log DNA ladder.

The gel picture is below:

06032014 BioE 140L Gel Pic.jpg

1st lane = DNA ladder

2nd lane = TrpRS product, should be 1008 bp

3rd lane = TyrRS product, should be 1260 bp

4th lane = ArgRS product, Chris's product

5th lane = SerRS product, Chris's product

6th lane = GlnRS subunit C product, Tae's product

TrpRS is a very faint band. The professor recommends re-doing that PCR with the pcr product from the first time as template to get a higher concentration. TyrRS looks great.

I also did the PCR Zymogen clean up for all my pcr products and eluted them all in 33 uL ddH2O.

March 11th

Karim R. Merchant 22:26, 13 March 2014 (EDT)

Today I redid my TrpRS PCR using the product of the TrpRS PCR I did week as template. I did this due to the fact that my product concentration seemed a little low based on the band intensity on the March 6th gel. I used the exact same reaction mixture and thermocycle set-up as is written on the March 4th notebook entry. The only difference was that the PCR template DNA was not the Thermotoga Maritima genome, but the original TrpRS PCR product, which had undergone Zymogen DNA cleanup.

PCR:

24 uL ddH2O

3.3 uL Expand Buffer 2

3.3 uL dNTP 2mM in each stock

1 uL 10 uM TrpRS primer 1

1 uL 10 uM TrpRS primer 2

0.5 TrpRS Pcr-product

0.5 uL Expand Polymerase 1

=33.6 uL total

The Thermocycler set up was:

1. 94°C for 2 min

2. 94°C for 15 sec

3. 55°C for 30 sec (should be lower than Tm of all primers)

4. 72°C for 2 min (1 min/kilobase)

5. Go to step 2 30x

6. 72°C for 7 min

7. 16°C for ever.

March 13th

Karim R. Merchant 22:26, 13 March 2014 (EDT)

Today I ran a gel of my second TrpRS PCR, and also did the Zymogen DNA cleanup (elute in 33 uL ddH2O) for it. The image is below:

13032014 BioE 140L Group 4 Gel.jpg

First lane is the Quick Load 2-Log DNA ladder. In the second lane was my product: TrpRS should be 1008 bp, so it looks like it's in the right spot. It's also quite bright, indicating there's a lot of the product. The only bad side was that the gel had a "smile", and the lanes all curved. At least the gel was happy.

The other lanes (lane 3 and on) had other classmates' products.

March 18th

Karim R. Merchant 23:31, 18 March 2014 (EDT)

Today I did 3 digestions, and a gel clean-up of the digested products. The reactions were as below:

TrpRS Digestion:

8 uL TrpRS Second PCR product

1 uL NEB Buffer 2

0.5 uL EcoRI

0.5 uL NcoI

=10 uL


TyrRS Digestion:

8 uL TyrRS PCR product

1 uL NEB CutSmart Buffer

0.5 uL BsaI

0.5 uL ddH2O

=10 uL


pBAD myc-his-A plasmid vector Digestion:

15 uL vector mini-prep product

3 uL NEB Buffer 2

1.5 uL EcoRI

1.5 uL NcoI

9 uL ddH2O

=30 uL

I centrifuged the reaction mixtures and left them at 37 degrees Celsius for 1 hour.

Next I did a gel purification clean up with ZymoGen. The protocol can be found here: JCA Protocols

An image of the gel is here: Group 4 Karim Digestion Gel 18032014.jpg

The first lane is Quick load 2 log DNA ladder. The second lane is TrpRS digestion product. The third lane is TyrRS digestion product. The next 3 lanes are all vector digestion products. TrpRS should have a band at 992 bp after digestion, as it does. TyrRS should have a band at 1232 bp after digestion, as it does. The vector digest should have a band at 4053 bp, as it does. All digests went smoothly. Next step is ligation and transformation. TrpRS and TyrRS digestions were eluted after gel cleanup in 10 uL of water, and the the vector digest was eluted in 15 uL.

April 1st

Karim R. Merchant 00:42, 4 April 2014 (EDT)

Today I did the ligation of TrpRS and TyrRS with the pBAD myc his A vector backbone.

There were 3 ligations:


TrpRS and TyrRS:

6.5 uL ddH2O

1 uL T4 DNA Ligase Buffer

1 uL pBAD digested backbone

1 uL digested insert

0.5 uL T4 DNA Ligase

--

10uL


Negative control:

7.5 uL ddH2O

1 uL T4 DNA Ligase Buffer

1 uL pBAD digested backbone

0.5 uL T4 DNA Ligase

--

10uL

I mixed and centrifuged all the ligations and left them at room temperature for 30 minutes.

Next I transformed all 3 of them.

I added 35 uL of KCM to 3 alliquots of 100 uL cells. Next I cooled them for 1 minute. Then I added 65 uL of the KCM+cell mixture to each 10 uL ligation product. I cooled all the cells on ice for 10 minutes. Then I heat shocked the cells at 42 degrees Celsius for 90 seconds (the heat block said 42 but the thermometer read 37). Next I cooled the cells for 1 minute. Then I did a rescue step where i added 100 uL of LB media to each cell alliquot and shook it at 37 degrees celsius for 1 hour. Finally I plated 100 uL of cell juice on ampicillin plates. Total = 3 plates = TrpRS, TyrRS, and negative control.

April 3rd

Karim R. Merchant 00:49, 4 April 2014 (EDT)

None of the plates from last time had any colonies. The professor and I think the heat shock failed. We agreed on 3 modifications for next time: use double the amount of insert during the ligations, use water in the heat shock block or better yet use the thermocycler, and finally also do a positive control using the miniprep plasmid with 0.5 uL of plasmid DNA in the transformation.

I was unable to do this today as there were not enough cells in lab. I will do this on Tuesday.

April 8th

Karim R. Merchant 01:40, 15 April 2014 (EDT)

I redid the TrpRS and TyrRS ligations/transformations using the same protocols as last time. My ligation reactions were as follows:

TrpRS and TyrRS:

5.5 uL ddH2O

1 uL T4 DNA Ligase Buffer

1 uL pBAD digested backbone

2 uL digested insert

0.5 uL T4 DNA Ligase

--

10uL


Negative control:

7.5 uL ddH2O

1 uL T4 DNA Ligase Buffer

1 uL pBAD digested backbone

0.5 uL T4 DNA Ligase

--

10uL

I mixed and centrifuged all the ligations and left them at room temperature for 30 minutes.

Afterwards I did the transformations of those 3 reactions along with the transformation of a positive control with 0.5 uL of pBadmychisA plasmid (undigested) into 30 uL of cells. All transformations were on ampicillin plates.

I added 35 uL of KCM to 3 alliquots of 100 uL cells. Next I cooled them for 1 minute. Then I added 65 uL of the KCM+cell mixture to each 10 uL ligation product. I also added 0.5 uL of the pBad-myc-his-A miniprep product to 30 uL of KCM+cell mixture as a positive control. I cooled all the cells on ice for 10 minutes. Then I heat shocked the cells at 42 degrees Celsius for 90 seconds in the thermocycler. Next I cooled the cells for 1 minute. Then I added 100 uL of LB media to each cell alliquot and plated 100 uL of cell juice on ampicillin plates. Total = 4 plates = TrpRS, TyrRS, negative control and positive control. I did not do a rescue step of growing the cells in the LB media for an hour before plating as the Professor explained that the reaction mechanism of ampicillin affects dividing cells and that the cells, even when placed in the incubator for 1 hour, won't begin dividing for a while after. The rescue step is necessary when a protein made by the cell is necessary to thwart the antibiotic, such as in the use of kanamycin.

April 10th

Karim R. Merchant 01:45, 15 April 2014 (EDT)

Again there were no colonies on the TrpRS, TyrRS, and negative control plates. The professor believed that there were far fewer colonies than there should be in the positive control plate due to the amount I had plated (100uL plated of the 30uL cell+35uL KCM+100uL media juice). He recommended me to retry the ligation/transformation procedure under his watch on Tuesday. He also recommended me to use someone else's backbone digest.

April 15th

Karim R. Merchant 04:08, 29 April 2014 (EDT)

Today I redid my ligations and transformations exactly the same way I did on April 8th, just with the watchful eye of the Professor. The professor watched my entire transformation procedure, making sure I didn't make any mistakes or miss any steps. I do not believe I made any change in the protocol from April 8th, except that I used my group-mate, Chris Coates' digested backbone DNA for my ligations instead of my own (with his permission of course).

Protocol: 

Ligation: 

TrpRS and TyrRS:

5.5 uL ddH2O

1 uL T4 DNA Ligase Buffer

1 uL pBAD digested backbone

2 uL digested insert

0.5 uL T4 DNA Ligase

-- 

10uL



Negative control:

7.5 uL ddH2O

1 uL T4 DNA Ligase Buffer

1 uL pBAD digested backbone

0.5 uL T4 DNA Ligase

-- 

10uL

I mixed and centrifuged all the ligations and left them at room temperature for 30 minutes.  

Afterwards I did the transformations of those 3 reactions along with the transformation of a positive control with 0.5 uL of pBadmychisA    
plasmid (undigested) into 30 uL of cells. All transformations were on ampicillin plates.

I added 35 uL of KCM to 3 alliquots of 100 uL cells. Next I cooled them for 1 minute. Then I added 65 uL of the KCM+cell mixture to each 10  
uL ligation product. I also added 0.5 uL of the pBad-myc-his-A miniprep product to 30 uL of KCM+cell mixture as a positive control. I cooled 
all the cells on ice for 10 minutes. Then I heat shocked the cells at 42 degrees Celsius for 90 seconds in the thermocycler. Next I cooled 
the cells for 1 minute. Then I added 100 uL of LB media to each cell alliquot and plated 100 uL of cell juice on ampicillin plates. Total = 4 
plates = TrpRS, TyrRS, negative control and positive control. I did not do a rescue step of growing the cells in the LB media for an hour  
before plating, as it was unnecessary.

April 17th

Karim R. Merchant 01:27, 4 May 2014 (EDT)

My sample plates again had no colonies- this was the third time I had tried the ligation/transformation and had no colonies. I spoke with the Professor about what my next options were and he told me that this was probably happening due to residual ethanol from the cleanup of my digested products which was preventing my ligation from occurring. I decided to redo my PCR's.

Just as before, for TrpRS, my primers were TrpRS NcoI Fwd/TrpRS EcoRI Rv, and for TyrRS my primers were TyrRS BsaI NcoI Fwd/TyrRS BsaI EcoRI Rv. Both PCRs were below 2 kilobases in length.

For TyrRS I decided to use the genomic DNA of Thermotoga Maritima as template DNA, while for TrpRS, I decided to use my very first TrpRS PCR product from the previous cycle of PCR I had done as template DNA. I decided this as last time TrpRS had given me a very faint band, and I had had to use that product for another round of PCR anyway to get a higher concentration. Thus using that low concentration TrpRS for the template this round should be okay, as it will basically just be a redo of the second PCR.

For both PCRs, I followed the following mixture setup (same as last time):

24 uL ddH2O

3.3 uL Expand Buffer 2

3.3 uL dNTP 2mM in each stock

1 uL 10 uM primer 1

1 uL 10 uM primer 2

0.5 uL template DNA

0.5 uL Expand Polymerase 1

=33.6 uL total

The Thermocycler set up was:

1. 94°C for 2 min

2. 94°C for 15 sec

3. 55°C for 30 sec (should be lower than Tm of all primers)

4. 72°C for 2 min (1 min/kilobase)

5. Go to step 2 30x

6. 72°C for 7 min

7. 16°C for ever.

Danny told me he would take the PCR tubes out of the thermocycler when it was done and put them in the freezer.

April 22nd

Karim R. Merchant 01:36, 4 May 2014 (EDT)

First I did the Zymogen DNA cleanup on my PCR products TyrRS and TrpRS from last time. I eluted each in 33.6 uL of water.

Next I set up digestions of my PCR products and pBadmychisA vector.

For TyrRS, my reaction was: 

8 uL TyrRS PCR product

1 uL NEB cutsmart buffer

0.5 uL BSAI enzyme

0.5 uL ddH2O

---

10 uL
For TrpRS, my reaction was:

8 uL TrpRS PCR product

1 uL NEB buffer2

0.5 uL EcoRI enzyme

0.5 uL NcoI enzyme

---

10 uL
For pBadmychisA vector, my reaction was:

5 uL pBadmychisA miniprep product vector

1 uL NEB buffer2

3 uL ddH2O

0.5 uL EcoRI enzyme

0.5 uL NcoI enzyme

---

10 uL

I centrifuged all the digestion reactions and left them at 37 degrees Celsius for 1 hour.

I next ran all the Digested DNA, along with the PCR products from before the digests on a gel.

4.22 KM 140L Digests.jpg GeneRuler 1kB+ DNA ladder.jpg

Lane 1(leftmost): TyrRS digested product = 1232 bp

Lane 2: TyrRS undigested PCR product = 1260 bp

Lane 3: TrpRS digested product = 992 bp

Lane 4: TrpRS undigested PCR product = 1008 bp

Lane 5: pBadmychisA digested vector = 4055 bp + 1252 bp --> want top band

Lane 6: empty

Lane 7: pBadmychisA undigested miniprep product vector

Lane 8: Generuler 1kB Plus Ladder http://www.thermoscientificbio.com/nucleic-acid-electrophoresis/generuler-1-kb-plus-dna-ladder-75-to-20000-bp/

All bands appear at correct sizes, except for the fact that it can be seen that there is a matching band in lanes 5 and 8 indicating that some of the digested vector in lane 5 top band is in fact undigested.

While doing the gel purifications of all of the digested fragments, I made sure to cut out the top portion of the vector digest top band, getting mostly the digested vector fragment, and hopefully none of the undigested vector. If any undigested vector bleeds through, hopefully it will be taken out by the column purification. But if it gets through that too, my transformation will most likely fail as instead of the ligation product being taken up by the bacteria, it will be the original pBadmychisA vector that we received.

After doing the gel purifications of all the digested bands of correct sizes, I eluted the insert digests in 10 uL water and the vector digest in 30 uL water (thinking that my group mates might need to use it).

April 23rd

Karim R. Merchant 02:07, 4 May 2014 (EDT)

Today I did ligations and transformations of my digests from yesterday. I followed the protocol from April 15th. I used all digests that I had purified yesterday.

Protocol: 

Ligation: 

TrpRS and TyrRS:

5.5 uL ddH2O

1 uL T4 DNA Ligase Buffer

1 uL pBAD digested backbone

2 uL digested insert

0.5 uL T4 DNA Ligase

-- 

10uL



Negative control:

7.5 uL ddH2O

1 uL T4 DNA Ligase Buffer

1 uL pBAD digested backbone

0.5 uL T4 DNA Ligase

-- 

10uL

I mixed and centrifuged all ligations and left them at room temperature for 30 minutes.

Afterwards I did the transformations of those 3 reactions. All transformations were on ampicillin plates.

I added 35 uL of KCM to 3 alliquots of 100 uL cells. Next I cooled them for 1 minute. Then I added 65 uL of the KCM+cell mixture to each 10  
uL ligation product. I cooled all the cells on ice for 10 minutes. Then I heat shocked the cells at 42 degrees Celsius for 90 seconds in the  
thermocycler. Next I cooled the cells for 1 minute. Then I added 100 uL of LB media to each cell alliquot and plated 100 uL of cell juice on 
ampicillin plates. Total = 3 plates = TrpRS, TyrRS, and negative control. I did not do a rescue step of growing the cells in 
the LB media for an hour before plating, as it was unnecessary.  

Also this time I did not do a positive control.

April 24th

Karim R. Merchant 02:20, 4 May 2014 (EDT)

My transformations worked! Both TyrRS and TrpRS had colonies, while there were no colonies on the negative control plate. I was quite happy.

Today I did inoculations of 4 colonies from each plate.

I took 8 plastic test tubes and, using sterile technique, added 4 mL of LB media to each tube, along with 4 uL of 1000X ampicillin to each tube. Next I picked 4 colonies (separately, 1 at a time) from the TrpRS plate and added each colony to 1 test tube, and I did the same for the TyrRS plate. I labeled all tubes appropriately: TrpRS1, TrpRS2, TrpRS3, TrpRS4, TyrRS1, TyrRS2, TyrRS3, TyrRS4, along with my initials and date on each tube. Danny then put the tubes in the 2nd floor warm room in Stanley until tomorrow.

April 25th

Karim R. Merchant 02:24, 4 May 2014 (EDT)

Today I did minipreps to collect all the plasmid DNA from my inoculations from yesterday.

The protocol for the minipreps is found here: http://openwetware.org/wiki/Arking:JCAProtocols

At the final stage, I eluted all inoculations in 50 uL ddH2O.

April 29th

Karim R. Merchant 02:35, 4 May 2014 (EDT)

The Professor sent out the sequence of the original pBad plasmid we received: Media:pBadmychisA.str

This is the sequence of my final plasmid maps:

TrpRS: Media:TrpRS Plasmid Map.ape

TyrRS: Media:TyrRS Plasmid Map.ape

Today I did my digestion mapping of my miniprep plasmids, to see if they match up with my expected product sizes.

For TrpRS, I noticed that there is a BglII site in the TrpRS insert that is not present anywhere in the original vector. Thus I decided to digest the original pBadmychisA vector along with my TrpRS samples with EcoRI and BglII to see if I get 1 or 2 bands. If I get 1 band, it indicates my TrpRS insert is not present, and thus the plasmid is the original pBadmychisA vector. If I get 2 bands, it indicates that my TrpRS insert successfully ligated into the backbone vector. My expected sizes for the bands are 4416 bp and 631 bp, assuming that TrpRS ligated into the backbone. If it didn't ligate in, I should get only 1 band from the EcoRI digestion at a size of 5307 bp.

For TyrRS, I noticed that there is a NcoI site in the TyrRS insert. Thus I decided to digest the original pBadmychisA vector along with my TyrRS samples with NcoI to see if I get 1 or 2 bands. If it's the original vector, it should only get digested once at NcoI, leaving a band at 5307 bp. If TyrRS insert successfully inserted into the backbone, it should get cut twice with NcoI, giving 2 bands at sizes of 4386 bp and 901 bp.

My digestions were:

pBadmychisA: BglII and EcoRI

3 uL of pBadmychisA vector

1 uL of NEB buffer 2

5 uL ddH2O

0.5 uL EcoRI

0.5 uL BglII

----

10 uL
TrpRS samples 1-4: BglII and EcoRI

3 uL of TrpRS sample

1 uL of NEB buffer 2

5 uL ddH2O

0.5 uL EcoRI

0.5 uL BglII

----

10 uL
pBadmychisA: NcoI

3 uL of pBadmychisA vector

1 uL of NEB buffer 2

5.5 uL ddH2O

0.5 uL NcoI

----

10 uL
TyrRS samples 1-4: NcoI

3 uL of TyrRS sample

1 uL of NEB buffer 2

5.5 uL ddH2O

0.5 uL NcoI

----

10 uL

I centrifuged all the digestion reactions and left them at 37 degrees Celsius for 1 hour.

Next I made 2 1% agarose gels, one each for TrpRS and TyrRS.

I ran my digested products on the gel.

TrpRS: GeneRuler 1kB+ DNA ladder.jpg140L TrpRS.jpg

Lane 1: Generuler 1kB+ DNA ladder

Lane 2: pBadmychisA original vector digested with BglII and EcoRI. Only 1 enzyme managed to digest, which resulted in a band at 5307 bp.

Lane 3-6: TrpRS samples 1-4. All samples were digested with both BglII and EcoRI resulting in 2 bands at 4416 bp and 631 bp.

TyrRS: GeneRuler 1kB+ DNA ladder.jpg140L TyrRS.jpg

Lane 1: Generuler 1kB+ DNA ladder

Lane 2: pBadmychisA original vector digested with NcoI, which managed to digest the vector in only 1 location (as the TyrRS insert was not in the original vector), resulting in a band at 5307 bp.

Lane 3-6: TyrRS samples 1-4. All samples were digested with only NcoI, and all resulted in 2 bands at 4386 bp and 901 bp, as the TyrRS insert itself had another NcoI site.

Thus from my gels, it is clear that all my samples are sequencing worthy, as they all seem to be the correct product.

May 1st

Karim R. Merchant 03:08, 4 May 2014 (EDT)

Today I submitted 2 samples of both TrpRS and TyrRS to Professor Anderson to be forward sequenced.

May 2nd

Karim R. Merchant 03:12, 4 May 2014 (EDT)

Today I received my sequencing results.

Media:KM TrpRS and TyrRS Forward Sequencing.zip

It appears as though only 1 sample of each TrpRS and TyrRS was forward sequenced, even though I gave 2 samples of each to be sequenced. It doesn't matter though as the samples that are sequenced appear to be perfect partials, matching very well with the beginning half of each TrpRS and TyrRS gene. The next step would be to do a reverse sequencing to confirm that the entirety of both genes are correct.