Sbb14-Akash Jain

From OpenWetWare
Jump to: navigation, search

Tuesday Feb. 13

The bacteria chosen is: Thermus thermophilus

10 oligos pet team.

Each individual will be working on 2 oligos for two seperate Amino Acids.

I've been assigned Q (Glutamine) and Y (Tyrosine)


Thursday Feb. 15

We worked on finding the sequences that would encode those amino acids.

We found the complete genome for Thermus Thermophilus, found here: http://www.ncbi.nlm.nih.gov/nuccore/NC_006461.1?report=gbwithparts&log$=seqview&sat=4

Using the complete genome, we found sequences for the individual genes.

>The gene that encodes for the Glutamyl-tRNA synthetase: TTHA0438
atggtggtgacccgcatcgcgccaagccccacgggcgacccccacgtgggcacggcctacatcgccctcttcaactacgcctgggcccggaggaacgggg
ggcgcttcatcgtgcgcattgaggacacggaccgggcgcgctacgtccccggggccgaggaaaggatcctcgccgccttaaagtggcttggcctctccta
cgacgagggccccgatgtgggcggcccccacgggccctaccgccagtcggaacggcttcccctctaccaaaagtacgccgaggagctcctcaagcggggg
tgggcctaccgggcctttgagaccccggaggagctagagcaaatccgcaaggaaaaggggggctacgacgggagggcccggaacatcccccctgaggagg
ccgaggagcgggcgaggcggggcgagccccacgtgatccgcctcaaggtgccccgccccgggaccacggaggtcaaggacgagctcaggggggtggtggt
ctacgacaaccaggagatccccgacgtggtcctcctcaagtccgacggctaccccacctaccacctggccaacgtggtggacgaccacctcatgggggtc
acggacgtgatccgggcggaggagtggctcgtctccacccccatccacgtcctcctctaccgggccttcggctgggaggcgccccggttctaccacatgc
ccctcctgcgcaaccccgacaagaccaagatctccaagcgcaaaagccacacctccctggactggtacaaggcggaggggtttctgcccgaggccctgag
gaactacctctgcctcatggggttctccatgcccgacgggcgggagatcttcaccctcgaggagttcatccaggccttcacctgggagagggtttccctg
ggggggcccgtctttgacctggaaaagctccgctggatgaacgggaagtacatccgggaggtgctctccctggaggaggtggcggagagggtcaagccct
tcctccgggaggcggggctttcctgggaaagcgaggcctacctgaggcgggcggtggagctcatgcgcccccggtttgacaccctgaaggagttcccgga
gaaggcccgctacctcttcaccgaggactaccccgtgtcggagaaggcccagaggaagctggaagaggggcttcccctcctcaaggagctctacccccgc
ctaagggcccaggaggagtggaccgaggccgccctcgaggccctcctccggggcttcgccgcggagaagggggtcaagctcggccaggtggcccagcccc
ttcgggccgccctcacggggagcctggagaccccggggctttttgagatcctggccctcctcgggaaggagcgggcgctcaggcgcttggagcgggccct
cgcctag
>The gene that encodes for the Tyrosyl-tRNA synthetase: TTHA1399
atggcgggcaccggccacaccccggaagaggccctggccctcctcaagcggggggccgaggagatcgtccccgaggaagagcttctcgccaagctcaagg
aggggcggcccctcacggtcaagctcggagccgaccccacgaggcccgacctgcacctgggccacgcggtggtcctgaggaagatgcgccagttccagga
gctcggccacaaggtggtcctcatcatcggcgacttcaccgggatgatcggggacccttcgggccgttccaagacccggccccccctcaccctggaggag
acccgggagaacgccaagacctacgtggcccaggcggggaagatcctcaggcaggagccccacctctttgagctccgctacaactccgagtggctggagg
gcctcaccttcaaggaggtggtgcgcctcacctccctcatgaccgtggcccagatgctggaaagggaggacttcaagaagcggtacgaggcggggattcc
catctccctgcacgagcttttgtaccccttcgcccaggcctacgactccgtggccataagggccgacgtggaaatggggggcacggaccagcgcttcaac
ctcctggtgggccgggaggtgcaacgggcctacgggcaaagcccccaggtctgcttcctcatgccccttctcgtgggccttgacgggcgggagaagatga
gcaagagcctggacaactacatcggcctcaccgagcccccggaggcgatgttcaagaagctcatgcgggtgccggaccctctcctcccgagctacttccg
gcttctcacggacctggaggaggaggaaatagaggccctcctaaaggcgggccccgtccccgcccaccgggtcctcgcccgcctcctcaccgcggcctac
gccctgccccagatccccccccggatagaccgggccttttacgaaagcctcggctacgcctgggaggccttcgggcgggacaaggaggcgggccccgagg
aggtaaggagggcggaagcccgctacgacgaggtggccaaagggggaatccccgaggagatccccgaggtcaccatccccgcctcggagctgaaggaagg
ccggatctgggtggcgaggctttttaccttagcgggcctcaccccctccaacgccgaggcgaggaggctcatccagaaccggggcctgaggctggacggg
gaggtcctcaccgaccccatgctccaggtggacctctcccggccccgcatcctgcagcggggcaaggaccgcttcgtgcgggtgcggctttcggactga

Tuesday Feb. 20

We worked on finishing our oligos, created the forward and reverse models for our individual genes.

The sequences are as follows:

>Glutamine Forward
gatctCCATGGtggtgacccgcatcgc
>Glutamine Reverse
ctgatGAATTCctaggcgagggcccgctcca
>Tyrosine Forward
catgtCCATGGcgggcaccggccacac
>Tyrosine Reverse
gtcatGAATTCtcagtccgaaagccgcacc

We also proofread each other's to ensure that our oligos are all correct.

Thursday, Feb. 27

Watched demo of mini prep and gel purification. We did our own mini prep in the remaining time.

Tuesday, Mar. 4

Set up our first batch of PCR. Made the master mix, diluted our oligos by a factor of 100x. To do this, we diluted it 20 times initially, and then 5 times again. Once we created the PCR product, we put it in the thermocycler to perform the reaction.

Thursday, Mar. 6

We ran a PCR for our group. Out of the syntases, approximately half failed. My tyrosine succeeded (last lane), but my guanine did not (2nd lane). I will have to reperform PCR on my product.

BioE140LG2Gel1.jpg

Friday, Mar. 7

Set up the PCR reactions for the failed synethetase for Guanine.

We also did Zymo Cleanup for our successful products, which for me was Tyrosine.

Tuesday, Mar. 11

Ran gel on the 2nd guanine PCR gel. This one also showed no good results. I'll have to try again.

Thursday, Mar. 13

Digested Tyrosine with EcoR1 and Nco1, and then did Zymo Cleanup of the digested product.

Tuesday, Mar. 18

Did a digestion of our previous mini prep, and incubated the product. All three wells were successful.

I set up another PCR reaction for guanine in the hopes that it will work this time. Had to remake "master mix."

Thursday, Mar. 20

We finished the Zymo Gel Purification on the wector digestion. I ligated Tyrosine with the vector digestion using ligaction process.

I set up the gel for the PCR. There are still no bands. I may have to try something new.

Thursday, Apr. 3

Plates did not turn out well. Redoing digestion.

PCR cannot be found. I'll have to run another PCR on my Q.

Friday, Apr. 4

Plates succeeded!

4-4-14 Thr Val Tyr.jpg

My Tyrosine infected E Coli are on the right most plate.

Unfortunately my PCR is gone yet again. Is someone stealing them? I've set up another PCR for the time being.

Tuesday, Apr. 8

I isolated the colonies for the tyrosine E. Coli into test tubes.

Ran the gel for the PCR. Did not turn out successful.

Thursday, Apr. 10

Miniprep on the colonies.


Tuesday, Apr. 15

Created a new PCR

Due to a shortage of gel boxes, we had to run zymo cleanup on our product.

Tursday, Apr. 17

Ran gel for PCR product and digested vector products.

4 17 14 Gel pdtvectdig.jpg

The right most three are: Ysquare Ycircle PCRQ

SUCCESSFUL! The Q has actual product! I'm so happy.

Ycircle is also very good.

Friday, Apr. 18

After lecture, I performed Zymo cleanup on the Q from the PCR, and then subsequently the digestion.

Gel after digestion unfortunately did not turn out well. I will have to run digestion again before I can ligate.

Thursday, Apr. 25

Gave sample and sequence to Prof. Anderson for sequencing. Waiting on results.

>For the Y, the sequence should be:
CATGGcgggcaccggccacaccccggaagaggccctggccctcctcaagcggggggccgaggagatcgtccccgaggaagagcttctcgccaagctcaag
gaggggcggcccctcacggtcaagctcggagccgaccccacgaggcccgacctgcacctgggccacgcggtggtcctgaggaagatgcgccagttccagg
agctcggccacaaggtggtcctcatcatcggcgacttcaccgggatgatcggggacccttcgggccgttccaagacccggccccccctcaccctggagga
gacccgggagaacgccaagacctacgtggcccaggcggggaagatcctcaggcaggagccccacctctttgagctccgctacaactccgagtggctggag
ggcctcaccttcaaggaggtggtgcgcctcacctccctcatgaccgtggcccagatgctggaaagggaggacttcaagaagcggtacgaggcggggattc
ccatctccctgcacgagcttttgtaccccttcgcccaggcctacgactccgtggccataagggccgacgtggaaatggggggcacggaccagcgcttcaa
cctcctggtgggccgggaggtgcaacgggcctacgggcaaagcccccaggtctgcttcctcatgccccttctcgtgggccttgacgggcgggagaagatg
agcaagagcctggacaactacatcggcctcaccgagcccccggaggcgatgttcaagaagctcatgcgggtgccggaccctctcctcccgagctacttcc
ggcttctcacggacctggaggaggaggaaatagaggccctcctaaaggcgggccccgtccccgcccaccgggtcctcgcccgcctcctcaccgcggccta
cgccctgccccagatccccccccggatagaccgggccttttacgaaagcctcggctacgcctgggaggccttcgggcgggacaaggaggcgggccccgag
gaggtaaggagggcggaagcccgctacgacgaggtggccaaagggggaatccccgaggagatccccgaggtcaccatccccgcctcggagctgaaggaag
gccggatctgggtggcgaggctttttaccttagcgggcctcaccccctccaacgccgaggcgaggaggctcatccagaaccggggcctgaggctggacgg
ggaggtcctcaccgaccccatgctccaggtggacctctcccggccccgcatcctgcagcggggcaaggaccgcttcgtgcgggtgcggctttcggactga
GAATTCGAAGCTTGGGCCCGAACAAAAACTCATCTCAGAAGAGGATCTGAATAGCGCCGTCGACCATCATCATCATCATCATTGAGTTTAAACGGTCTCC
AGCTTGGCTGTTTTGGCGGATGAGAGAAGATTTTCAGCCTGATACAGATTAAATCAGAACGCAGAAGCGGTCTGATAAAACAGAATTTGCCTGGCGGCAG
TAGCGCGGTGGTCCCACCTGACCCCATGCCGAACTCAGAAGTGAAACGCCGTAGCGCCGATGGTAGTGTGGGGTCTCCCCATGCGAGAGTAGGGAACTGC
CAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCG
GGAGCGGATTTGAACGTTGCGAAGCAACGGCCCGGAGGGTGGCGGGCAGGACGCCCGCCATAAACTGCCAGGCATCAAATTAAGCAGAAGGCCATCCTGA
CGGATGGCCTTTTTGCGTTTCTACAAACTCTTTTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTT
CAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAG
AAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCG
CCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGC
ATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAA
CCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCG
CCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTA
ACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTG
GCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTAT
CTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTT
TACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAAC
GTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAA
AAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACT
GTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCA
GTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAG
CTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTA
AGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGC
GTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCA
CATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGC
GAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATATGGTGCACTCTCAGTACAA
TCTGCTCTGATGCCGCATAGTTAAGCCAGTATACACTCCGCTATCGCTACGTGACTGGGTCATGGCTGCGCCCCGACACCCGCCAACACCCGCTGACGCG
CCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAAC
GCGCGAGGCAGCAGATCAATTCGCGCGCGAAGGCGAAGCGGCATGCATAATGTGCCTGTCAAATGGACGAAGCAGGGATTCTGCAAACCCTATGCTACTC
CGTCAAGCCGTCAATTGTCTGATTCGTTACCAATTATGACAACTTGACGGCTACATCATTCACTTTTTCTTCACAACCGGCACGGAACTCGCTCGGGCTG
GCCCCGGTGCATTTTTTAAATACCCGCGAGAAATAGAGTTGATCGTCAAAACCAACATTGCGACCGACGGTGGCGATAGGCATCCGGGTGGTGCTCAAAA
GCAGCTTCGCCTGGCTGATACGTTGGTCCTCGCGCCAGCTTAAGACGCTAATCCCTAACTGCTGGCGGAAAAGATGTGACAGACGCGACGGCGACAAGCA
AACATGCTGTGCGACGCTGGCGATATCAAAATTGCTGTCTGCCAGGTGATCGCTGATGTACTGACAAGCCTCGCGTACCCGATTATCCATCGGTGGATGG
AGCGACTCGTTAATCGCTTCCATGCGCCGCAGTAACAATTGCTCAAGCAGATTTATCGCCAGCAGCTCCGAATAGCGCCCTTCCCCTTGCCCGGCGTTAA
TGATTTGCCCAAACAGGTCGCTGAAATGCGGCTGGTGCGCTTCATCCGGGCGAAAGAACCCCGTATTGGCAAATATTGACGGCCAGTTAAGCCATTCATG
CCAGTAGGCGCGCGGACGAAAGTAAACCCACTGGTGATACCATTCGCGAGCCTCCGGATGACGACCGTAGTGATGAATCTCTCCTGGCGGGAACAGCAAA
ATATCACCCGGTCGGCAAACAAATTCTCGTCCCTGATTTTTCACCACCCCCTGACCGCGAATGGTGAGATTGAGAATATAACCTTTCATTCCCAGCGGTC
GGTCGATAAAAAAATCGAGATAACCGTTGGCCTCAATCGGCGTTAAACCCGCCACCAGATGGGCATTAAACGAGTATCCCGGCAGCAGGGGATCATTTTG
CGCTTCAGCCATACTTTTCATACTCCCGCCATTCAGAGAAGAAACCAATTGTCCATATTGCATCAGACATTGCCGTCACTGCGTCTTTTACTGGCTCTTC
TCGCTAACCAAACCGGTAACCCCGCTTATTAAAAGCATTCTGTAACAAAGCGGGACCAAAGCCATGACAAAAACGCGTAACAAAAGTGTCTATAATCACG
GCAGAAAAGTCCACATTGATTATTTGCACGGCGTCACACTTTGCTATGCCATAGCATTTTTATCCATAAGATTAGCGGATCCTACCTGACGCTTTTTATC
GCAACTCTCTACTGTTTCTCCATACCCGTTTTTTTGGGCTAACAGGAGGAATTAAC

For the Q, used the eluted product to run digestion. Ran ligation on the digestion product, and did transformation subsequently. Out of plates, so I will plate tomorrow.

Friday, Apr. 27

Plate had colonies. I will pick these out and incubate in LB media with antibioitic till next week.

QPlate.jpeg

Tuesday, Apr. 29

Recieved my sequence back from the Y sample and used [[Georgetown's Pairwise Alignment Tool[1]]] to compare the sequences. It found a 99.9% of match for a region of 836 bp (with one minor misread downstream).

Results:

Yseqresults.jpeg


Picked 4 colonies of the Q and put them for incubation in 5 ml of media. I will run the miniprep purification and digestion on the product on thursday, and submit my product.

>Expected DNA for the Q: 
CATGGtggtgacccgcatcgcgccaagccccacgggcgacccccacgtgggcacggcctacatcgccctcttcaactacgcctgggcccggaggaacggg
gggcgcttcatcgtgcgcattgaggacacggaccgggcgcgctacgtccccggggccgaggaaaggatcctcgccgccttaaagtggcttggcctctcct
acgacgagggccccgatgtgggcggcccccacgggccctaccgccagtcggaacggcttcccctctaccaaaagtacgccgaggagctcctcaagcgggg
gtgggcctaccgggcctttgagaccccggaggagctagagcaaatccgcaaggaaaaggggggctacgacgggagggcccggaacatcccccctgaggag
gccgaggagcgggcgaggcggggcgagccccacgtgatccgcctcaaggtgccccgccccgggaccacggaggtcaaggacgagctcaggggggtggtgg
tctacgacaaccaggagatccccgacgtggtcctcctcaagtccgacggctaccccacctaccacctggccaacgtggtggacgaccacctcatgggggt
cacggacgtgatccgggcggaggagtggctcgtctccacccccatccacgtcctcctctaccgggccttcggctgggaggcgccccggttctaccacatg
cccctcctgcgcaaccccgacaagaccaagatctccaagcgcaaaagccacacctccctggactggtacaaggcggaggggtttctgcccgaggccctga
ggaactacctctgcctcatggggttctccatgcccgacgggcgggagatcttcaccctcgaggagttcatccaggccttcacctgggagagggtttccct
gggggggcccgtctttgacctggaaaagctccgctggatgaacgggaagtacatccgggaggtgctctccctggaggaggtggcggagagggtcaagccc
ttcctccgggaggcggggctttcctgggaaagcgaggcctacctgaggcgggcggtggagctcatgcgcccccggtttgacaccctgaaggagttcccgg
agaaggcccgctacctcttcaccgaggactaccccgtgtcggagaaggcccagaggaagctggaagaggggcttcccctcctcaaggagctctacccccg
cctaagggcccaggaggagtggaccgaggccgccctcgaggccctcctccggggcttcgccgcggagaagggggtcaagctcggccaggtggcccagccc
cttcgggccgccctcacggggagcctggagaccccggggctttttgagatcctggccctcctcgggaaggagcgggcgctcaggcgcttggagcgggccc
tcgcctagGAATTCGAAGCTTGGGCCCGAACAAAAACTCATCTCAGAAGAGGATCTGAATAGCGCCGTCGACCATCATCATCATCATCATTGAGTTTAAA
CGGTCTCCAGCTTGGCTGTTTTGGCGGATGAGAGAAGATTTTCAGCCTGATACAGATTAAATCAGAACGCAGAAGCGGTCTGATAAAACAGAATTTGCCT
GGCGGCAGTAGCGCGGTGGTCCCACCTGACCCCATGCCGAACTCAGAAGTGAAACGCCGTAGCGCCGATGGTAGTGTGGGGTCTCCCCATGCGAGAGTAG
GGAACTGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAA
ATCCGCCGGGAGCGGATTTGAACGTTGCGAAGCAACGGCCCGGAGGGTGGCGGGCAGGACGCCCGCCATAAACTGCCAGGCATCAAATTAAGCAGAAGGC
CATCCTGACGGATGGCCTTTTTGCGTTTCTACAAACTCTTTTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGAT
AAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGC
TCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAG
AGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCG
GTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGC
TGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCAT
GTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCA
AACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCT
TCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATC
GTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAG
ACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAAT
CCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTG
CAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATAC
CAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGC
TGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACA
CAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGT
ATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTG
ACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCT
TTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCG
AGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATATGGTGCACTCT
CAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTATACACTCCGCTATCGCTACGTGACTGGGTCATGGCTGCGCCCCGACACCCGCCAACACCCG
CTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATC
ACCGAAACGCGCGAGGCAGCAGATCAATTCGCGCGCGAAGGCGAAGCGGCATGCATAATGTGCCTGTCAAATGGACGAAGCAGGGATTCTGCAAACCCTA
TGCTACTCCGTCAAGCCGTCAATTGTCTGATTCGTTACCAATTATGACAACTTGACGGCTACATCATTCACTTTTTCTTCACAACCGGCACGGAACTCGC
TCGGGCTGGCCCCGGTGCATTTTTTAAATACCCGCGAGAAATAGAGTTGATCGTCAAAACCAACATTGCGACCGACGGTGGCGATAGGCATCCGGGTGGT
GCTCAAAAGCAGCTTCGCCTGGCTGATACGTTGGTCCTCGCGCCAGCTTAAGACGCTAATCCCTAACTGCTGGCGGAAAAGATGTGACAGACGCGACGGC
GACAAGCAAACATGCTGTGCGACGCTGGCGATATCAAAATTGCTGTCTGCCAGGTGATCGCTGATGTACTGACAAGCCTCGCGTACCCGATTATCCATCG
GTGGATGGAGCGACTCGTTAATCGCTTCCATGCGCCGCAGTAACAATTGCTCAAGCAGATTTATCGCCAGCAGCTCCGAATAGCGCCCTTCCCCTTGCCC
GGCGTTAATGATTTGCCCAAACAGGTCGCTGAAATGCGGCTGGTGCGCTTCATCCGGGCGAAAGAACCCCGTATTGGCAAATATTGACGGCCAGTTAAGC
CATTCATGCCAGTAGGCGCGCGGACGAAAGTAAACCCACTGGTGATACCATTCGCGAGCCTCCGGATGACGACCGTAGTGATGAATCTCTCCTGGCGGGA
ACAGCAAAATATCACCCGGTCGGCAAACAAATTCTCGTCCCTGATTTTTCACCACCCCCTGACCGCGAATGGTGAGATTGAGAATATAACCTTTCATTCC
CAGCGGTCGGTCGATAAAAAAATCGAGATAACCGTTGGCCTCAATCGGCGTTAAACCCGCCACCAGATGGGCATTAAACGAGTATCCCGGCAGCAGGGGA
TCATTTTGCGCTTCAGCCATACTTTTCATACTCCCGCCATTCAGAGAAGAAACCAATTGTCCATATTGCATCAGACATTGCCGTCACTGCGTCTTTTACT
GGCTCTTCTCGCTAACCAAACCGGTAACCCCGCTTATTAAAAGCATTCTGTAACAAAGCGGGACCAAAGCCATGACAAAAACGCGTAACAAAAGTGTCTA
TAATCACGGCAGAAAAGTCCACATTGATTATTTGCACGGCGTCACACTTTGCTATGCCATAGCATTTTTATCCATAAGATTAGCGGATCCTACCTGACGC
TTTTTATCGCAACTCTCTACTGTTTCTCCATACCCGTTTTTTTGGGCTAACAGGAGGAATTAAC


Thursday, May 1

Did miniprep and digestion of 4 colonies, and created the final products.

I ran a gel, here are the results:

Qgel1.jpg Qgel2.jpg

Qa Qb Ladder Qx Qy

It's faint, but Qx and Qy are present.

I submitted Qx to Chris for sequencing.

Friday, May 2

Recieved my sequence back from the Q sample and used [[Georgetown's Pairwise Alignment Tool[2]]] to compare the sequences. It found a 97.6% of match for a region of 164 bp.

Results:

Qseqresults.jpeg