From OpenWetWare
Jump to: navigation, search


This is the human Melanocortin-4 receptor with the 5' and 3' noncoding sequences removed. The receptor is cloned into pcDNA 3.1 and has the prolactin signal sequence added at the 5' end of the gene (blue) followed by the FLAG epitope tag (red) and eGFP (purple). a-MSH binding and activation is unaltered in the receptor containing these tags. All DNA sequence data has been sequenced and confirmed to be accurate. The entire sequence (Sig. Seq.-FLAG-eGFP-hMC4R) can be moved as an ~2kb Xba1 casette. The 5' end of the gene has a unique EcoR1 site and the 3' end has a unique EcoRV site. The sequence of pcDNA3.1/hMC4R (tagged) is appended below, pcDNA sequence is shown in lower case.

gacggatcgggagatctcccgatcccctatggtcgactctcagtacaatctgctctgatgccgcatagtt aagccagtatctgctccctgcttgtgtgttggaggtcgctgagtagtgcgcgagcaaaatttaagctaca acaaggcaaggcttgaccgacaattgcatgaagaatctgcttagggttaggcgttttgcgctgcttcgcg atgtacgggccagatatacgcgttgacattgattattgactagttattaatagtaatcaattacggggtc attagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccg cccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttcc attgacgtcaatgggtggactatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgcc aagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgacctta tgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggc agtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaa tgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacg caaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctctctggctaactagagaaccca ctgcttactggcttatcgaaattaatacgactcactatagggagacccaagctggctagttaagcttggt accgagctcggatccactagtccagtgtggtggaattgcccttatcaattcagggggacactggaattcg cccttgcctatctagaataaacgctcaactttggcagatccaccATGGACAGCAAAGGTTCGTCGCAGAA AGGGTCCCGCCTGCTCCTGCTGCTGGTGGTGTCAAATCTACTCTTGTGCCAGGGTGTGGTCTCCGATTAC AAAGATGATGATGATGTCGACTCCCCGATCCAGATCTTCCGCGGCATGGTGAGCAAGGGCGAGGAGCTGT TCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGG CGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCC GTGCCCTGGCCCACCCTCGTGACCACCTTGACCTACGGCGTGCAGTGCTTCGCCCGCTACCCCGACCACA TGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAA GGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAG CTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCC ACAAGGTCTATATCACCGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGACCCGCCACAACAT CGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTG CTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACA TGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACCGGATCCTGAA CTCCACCCACCGTGGGATGCACACTTCTCTGCACCTCTGGAACCGCAGCAGTTACAGACTGCACAGCAAT GCCAGTGAGTCCCTTGGAAAAGGCTACTCTGATGGAGGGTGCTACGAGCAACTTTTTGTCTCTCCTGAGG TGTTTGTGACTCTGGGTGTCATCAGCTTGTTGGAGAATATCTTAGTGATTGTGGCAATAGCCAAGAACAA GAATCTGCATTCACCCATGTACTTTTTCATCTGCAGCTTGGCTGTGGCTGATATGCTGGTGAGCGTTTCA AATGGATCAGAAACCATTATCATCACCCTATTAAACAGTACAGATACGGATGCACAGAGTTTCACAGTGA ATATTGATAATGTCATTGACTCGGTGATCTGTAGCTCCTTGCTTGCATCCATTTGCAGCCTGCTTTCAAT TGCAGTGGACAGGTACTTTACTATCTTCTATGCTCTCCAGTACCATAACATTATGACAGTTAAGCGGGTT GGGATCAGCATAAGTTGTATCTGGGCAGCTTGCACGGTTTCAGGCATTTTGTTCATCATTTACTCAGATA GTAGTGCTGTCATCATCTGCCTCATCACCATGTTCTTCACCATGCTGGCTCTCATGGCTTCTCTCTATGT CCACATGTTCCTGATGGCCAGGCTTCACATTAAGAGGATTGCTGTCCTCCCCGGCACTGGTGCCATCCGC CAAGGTGCCAATATGAAGGGAGCGATTACCTTGACCATCCTGATTGGCGTCTTTGTTGTCTGCTGGGCCC CATTCTTCCTCCACTTAATATTCTACATCTCTTGTCCTCAGAATCCATATTGTGTGTGCTTCATGTCTCA CTTTAACTTGTATCTCATACTGATCATGTGTAATTCAATCATCGATCCTCTGATTTATGCACTCCGGAGT CAAGAACTGAGGAAAACCTTCAAAGAGATCATCTGTTGCTATCCCCTGGGAGGCCTTTGTGACTTGTCTA GCAGATATTAatggggacagagcacgcaatataggaacaaagggcaattctgcagatatccagcacagtg gcggccgctcgagtctagagggcccgcggttcgaaggtaagcctatccctaaccctctcctcggtctcga ttctacgcgtaccggtcatcatcaccatcaccattgagtttaaacccgctgatcagcctcgactgtgcct tctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactccca ctgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctgggggg tggggtggggcaggacagcaagggggaggattgggaagacaatagcaggcatgctggggatgcggtgggc tctatggcttctgaggcggaaagaaccagctggggctctagggggtatccccacgcgccctgtagcggcg cattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgc tcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcggggc atccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggtt cacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatag tggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggatt ttggggatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattaattctgtg gaatgtgtgtcagttagggtgtggaaagtccccaggctccccaggcaggcagaagtatgcaaagcatgca tctcaattagtcagcaaccaggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatg catctcaattagtcagcaaccatagtcccgcccctaactccgcccatcccgcccctaactccgcccagtt ccgcccattctccgccccatggctgactaattttttttatttatgcagaggccgaggccgcctctgcctc tgagctattccagaagtagtgaggaggcttttttggaggcctaggcttttgcaaaaagctcccgggagct tgtatatccattttcggatctgatcaagagacaggatgaggatcgtttcgcatgattgaacaagatggat tgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcgg ctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctg tccggtgccctgaatgaactgcaggacgaggcagcgcggctatcgtggctggccacgacgggcgttcctt gcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggca ggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctg catacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactc ggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaact gttcgccaggctcaaggcgcgcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttg ccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggacc gctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgctt cctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttc ttctgagcgggactctggggttcgcgaaatgaccgaccaagcgacgcccaacctgccatcacgagatttc gattccaccgccgccttctatgaaaggttgggcttcggaatcgttttccgggacgccggctggatgatcc tccagcgcggggatctcatgctggagttcttcgcccaccccaacttgtttattgcagcttataatggtta caaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttg tccaaactcatcaatgtatcttatcatgtctgtataccgtcgacctctagctagagcttggcgtaatcat ggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcat aaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgct ttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgc gtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggt atcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtga gcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcc cccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagata ccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctg tccgcctttctcccttcgggaagcgtggcgctttctcaatgctcacgctgtaggtatctcagttcggtgt aggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccgg taactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacagg attagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacacta gaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttg atccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaa aaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgtt aagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttt taaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacct atctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatac gggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagattt atcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatc cagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttg ccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacg atcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgtt gtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtca tgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcg gcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtg ctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcga tgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaa aacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttc ctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtattt agaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtc