SEED/2008/Sequencing

From OpenWetWare
Jump to: navigation, search

Expected sequences are listed here: SEED/2008/Sequences

Sequence results: (Raw chromatogram traces)

1. JK-1

NNNNNNNNTTNNgtGCCGAGAAGGcCCaCCCGTGAAGGTGAGCCAGTGAGTTGATTGCTACGTAATTAGTTAGTTAGCCC
TTAGTGACTCGAATTCGCGGCCGCTTCTAGAGTTTACAGCTAGCTCAGTCCTAGGTATTATGCTAGCTACTAGAGTCACA
CAGGAAAGTACTAGATGACCATGATTTACGGATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGT
TACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTT
CCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCGCGGGCGGCAGCGAAGGCGGCGGCAGCGAACATCATCATCATCAT
CATGGCAGCGAACGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGG
GCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTG
GAAAACTACCTGTTCCATGGCCAACACTTGTCACTACCCTGACCTATGGTGTTCAATGCTTTGCGAGATACCCAGATCAT
ATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGG
GAACTACAAGACACGTGCTGAAGTCAAGTTTGAANGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTA
AAGAANATGGAAACATTCTTGGACACAAATTGGNNTACAACTANNCTCACACAATGTATACATCATGGCAGACAAACAAA
GANGGAATCAAGTTAACTTCAAATAGACANANNTTGANATGNNCGTCANTAGCANACATATCACAAANACTCANNNGANN
NNTGTCNTTNCNNACACNTACTGTCNNNNANCNNCCNTNCNANNANNNNNAAANANNNANNNNGGNCCTCTNNNNNNNAN
NGCTNCTNGNNTNNCNTGGCANGGANGNNCNNNNNNNNNNNNCNAGTNNNNNNNNCNNNNNNNTNNNNNNTNNNTNNNTN
NNNNNNNAANNNNNNNNNNNNNNNNTNANNNNNNNGNNNNNNNNNTNN

2. JK-2

NNNNNNNANNTNNgtGCCGAGAAGGcCCACCCGTGAAGGTGAGCCAGTGAGTTGATTGCTACGTAATTAGTTAGTTAGCC
CTTAGTGACTCGAATTCGCGGCCGCTTCTAGAGTTTACGGCTAGCTCAGTCCTAGGTATAGTGCTAGCTACTAGAGTCAC
ACAGGAAAGTACTAGATGACCATGATTACGGATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGT
TACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTT
CCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCGCGGGCGGCAGCGAAGGCGGCGGCAGCGAACATCATCATCATCAT
CATGGCAGCGAACGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGG
GCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTG
GAAAACTACCTGTTCCATGGCCAACACTTGTCACTACCCTGACCTATGGTGTTCAATGCTTTGCGAGATACCCAGATCAT
ATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGG
GAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGNATTGATTTTA
AAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAA
AGAATGGAATCAAAGTTAACTTCAAATTAGACANANATTGANATGGANCGTTCACTAGCAGACATNTCACAAATACTCNN
NNGANGNCCTGTCNTTACNNANACNTACTGTCNCANATCTNCCTTNNNANNANCCNNNAAANANAGANNNNGNCNNTGNN
NNNANAGCTGCNNNNNTNNCATGNNNGNNGANCNNNNNNANANNNNNNNNNNNNNNCNNNNNNNTNNNNNNNNNNNNNNT
NNNNTNNCNNANNNNANNNNNNNNNNNNNNNCNNANNTNNNTGGGNNTNNNNNNGGN

3. JK-3

NNNNNNNAATTTNNgtGCCGAgAAGGCCCACCCGTGAAGGTGAGCCAGTGAGTTGATTGCTACGTAATTAGTTAGTTAGC
CCTTAGTGACTCGAATTCGCGGCCGCTTCTAGAGTTTACAGCTAGCTCAGTCCTAGGTATTATGCTAGCTACTAGAGTCA
CACAGGAAAGTACTAGATGACCATGATTACGGATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCG
TTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCT
TCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCGCGGGCGGCAGCGAAGGCGGCGGCAGCGAACATCATCATCATCA
TCATGGCAGCGAACGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATG
GGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACT
GGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACCCTGACCTATGGTGTTCAATGCTTTGCGAGATACCCAGATCA
TATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACG
GGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGNATTGATTTT
AAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACA
AAAGAATGGAATCAAAGTTAACTTCAAANTAGACACANATTGANATGGNANCGTTCANTAGCAGACATTATCACAAATAC
TNNTGNGANGGNCCTGTCNTTACNNANNNNTTACTGTCNNNNCATCTGNCNTTCNAANATCCCNNNAAANNAGNNACNNA
TGNNNNNGANTTGNANCAGCTGCTNGGNNNNNNCANNGCANGNNNANNNNNNNNAANANNNNTANNNNNGGNCNNNNNNG
NNNNCNCNNNNNNNNNNNNNNNNNANNNNNNNNANNNNCNNNNNNNNNNNTNNANNNAANNNNNNNNNNNGTNTNTNNNA
NNTNNNNGNC

4. JK-4

NNNNNNNNNNNNNgtGCCGAGAAGGCCCACCCGTGAAGGTGAGCCAGTGAGTTGATTGCTACGTAATTAGTTAGTTAGCC
CTTAGTGACTCGAATTCGTCCGGGCCGTTTTCAGCAATCATCTCCAGGCTCTTTGCCAGGTTCGCCTGCACCAGCGTGTC
GCCCTTTTTCAGCGGCTCGCCCTCTTTCCAGAAGATAGCTTTACTGTTTTCGTGATTCGGCAACACTTCGCTACCGTAGG
TTTTGAGATCGTCAGCCAGCGCGTCGTTAACGATAAAACCATCGCGTGCCAGTTTAAACGCGGGCTGCACGACTTTGTTC
AGCGGCATGGTGCCGTATTTATCCAGCGCCAGCGAGAAACCTGCTACCGTACCCGGTGTGCCGGAAGCCAGATGCGAAGT
GAGTGATTTTTTGCTGTCCGGGTTGCCCTGATCATCGAGGAACATATCGCGGGTCGCTTTGGCGGGTGCCATTTCGCGGA
AATCGATAGCCGTGGTATTGCCATTTTTCGAGCGGATTAACATAAAACCACCACCGCCCAGATTCCCTGCCTGCGGATGC
GTTACCGCCAGCGCGTAGCCCACCGCCACGGCGGCATCAACGGCATTCCCGCCCTCCTTGAGAATATCCACCCCCACCTG
AGTGGCAGTGGCGTCCACAGACGCTACCATTCCCTGTTTCGCGCGTACCGGGTGGAAGACATCTTCCTCCACACCATACG
AGACGGGCGGCGCANGAGGCGCGGCGGCGGCGCTAAAACAACTTCCTGAGAGCAGAGCAGCAATGGCCACCCGGCGTAAA
AACGTCGGTTTTATCATCGTTATTCTCCAGAGATTANGGGGCAACCCCAGCTAAGCCTGGTATATNACTCTGAATTAATC
ATCGTTTTGTCGGGAAGCGAGTAAACTTAAAGGATATCTTCAGAGGAGNTACGCGATGAAACGACTTCTGATTNTNCGGC
ACTNCTGCCGTTNGTCGGCTTGCNNNNNCCATNNNNNCTNTGACACCNANCAGCNGGGNNTCNNAANNCCNNCNGCAGCG
NTGCAANCCNGATGNNNACTNAGNNAATCNGCAAAANNNNGCTGANTCAGCNNCTNNANNNNNNNNCNNNNCNNNNNGCN
NNNAANNNNNNNNANNNNNNNNNANNNNNNNNGCNNNNNNNNNGNANNNATNCNNCNGNNNNCAANNNNNNNNCNNCNCA
NGNNNGNNNTNTTNNAN

5. KM-1

CNNNNNNNNNNNNNGGCCNANCNNGNGNNNGGGAGANNCNNTGNNNNNNNGNNNCNNAANNNCNNNNNNNNCCNTANNNN
NNNNANNNNANNNGGNNNNNNNNNNAANNNNCAGGNNNNNNAANGNANNNAGNANNAAANNNNNNNNNNA

6. KM-2

NNNNNNNNNNNNNNNNNNNNGNNNNTNNNNNNNNNNNNNNNNNNNNNNNGNNNNNTNNGNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNTNNNNNNNNGNNNNNNNNNNNANNNNNNNNNNNNNNNNNGNGANNNNNAGNTNCTNNNNNNNNNGNNNNNN
NCTNNNNNNNANNNNTTACNTACNCNNNNTNACNNANCNNACNNNNNNNNGCNNANNNNNNNNNNNTTGANNNNTANNNA
NNTNNNTNNNNGNNGGNNNNNTNNTNTTNNNTNTCNTNNNTTTTTTTTTTNTTTNNNNTTTTNTTNNTTTTTTTTTTTTN
TTNNNNTTTTTTTCNNNNNNTTTTTNNTNNNTNNNTTNNNGTANNTNNNTNNTTTTNCCCNTTNTCNNNNANNNNGNNNN
NNNNNNNNNTNNNNNNCNNNNNNANNNNANNNNNNNTNTANANNNNNNNNTANNNNNANNTNNNNNNNNNNNGNNNNNTN
NGNTANNNNNNNNNNNNANANNNTNNGNNTTTNTANNNNGNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNN
NNNGNANNNNNNNATNNTNTTANNNCNANNNNNNNNNNNNTNNNNNNNTTNNNNNNNNNATNNNCGTNNNNNNCNNNNNN
NAAANNNNNNNTAAGNNNNNNNNNNNNNNNTNCNNNNCNGANNNNNNNNNNANNNNNNNNNNNNNNANNNAGNNNNNNNN
GNNANNANNNANNNNNNNNNNNANCNNTCNNNNNNANNTNTANNNNANTANGANNNNNNNNNNNNNNNNNGNNNNNNNNN
NNNNNTNNNNNANTNNNNNNNCNNNNNNNNNNNNNNNNNNNNNGTNNNNANNNNNNNNNANNNNNNANNNNNNNNNNNNN
CGNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGNCNNNNNNNNANNNNNNNNNNNANNNNNNNNN
NNNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNGNNNNNNACNNNNNNNNNNNNNNNNNGGCNNNNNNNNNNNNNNNNATNNNNNNNNN

7. KM-3

NNNNN

8. KM-4

NNNNN

9. QV-1

NNNNNNNNNNNNNGCCGTGCCGAgAggCCCACCCGTGAAGGTGAGCCAGTGAGTTGATTGCTACGTAATTAGTTAGTTAG
CCCTTAGTGACTCGAATTCGCGGCCGCTTCTAGAGTTTACAGCTAGCTCAGTCCTAGGTATTATGCCTAGCTACTAGAGA
AAGAGGAGAAATACTAGATGACCATGATTACGGATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGC
GTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCC
TTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCGCGGGCGGCAGCGAAGGCGGCGGCAGCGAACATCATCATCATC
ATCATGGCAGCGAACGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAAT
GGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTAC
TGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACCCTGACCTATGGTGTTCAATGCTTTGCGAGATACCCAGATC
ATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGAC
GGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGtATTGATTT
TAAAGAAgATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAAC
AAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTGANATGGAAGCGTTCAACTAGCANACCATTATCANA
AATACTNCNNNGGCGATGGNCCTGTCNTTTTACAGANNNCATTACCTGTCCNNNCAATCTGNCCTTTCGAANGANCCCNN
NAAAAAGANNNGANNNNCNTGGNNNNNNTNNANTTTGTANCANCNGNCNGGGANTNNNNCNNNGNNNGGNNNNANNNNNC
NANNANNNNNNNNNNNNNNNNCCNNNNNNNGNANNNNNNNNGGNNNNNNNNNNNNNNNNNNNNNNNAANNNCNNNCNNNN
NNNNNNNNAANNNNNNNNNNNNGNNNNTNNNNNNNNNNNNGNGNNN

10. QV-2

NNNNNNNNNNNNNgtGCCgagAAGGcCCaCCCGTGAAGGtGAGCCAGTGAGTTGATTGCTACGTAATTagttAGTTAGCC
CTTAGTGACTCGAATTCGCGGCCGCTTCTAGAGCTGATAGCTAGCTCAGTCCTAGGGATTATGCTAGCTACTAGNNNNTN
NNNNNANNNNNNGGNNNGNGCNNNNNNNNNGNTCNNNNNGCGGCNGNNNATNNNNGNNNNNNNGGGNNANCNNNNNNNNN
NNNNNNNNTNNNCNNNNNGNNNCNCNTNNNGGNNGGNNCNNNNNNNNNNNGNNNNNNGNNNNNNNNNNNTNNNNNNNCNN
NNGNGttgcgcaGCCTGAATGGCGAATGGcGCGCGGGCGGCAGCGAAGGCGGCGGCAGCGAACATCATCaTCaTCATCAT
GGCAGCgAACGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCA
CaAaTTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAA
AACTACCTGTTCCATGgcCaACaCTTGTCACTACCCTGACCTATGGTGtTCAATGCTTTGcgAGATACCcagATCaTATG
AAACAGCATGACTTTTTCaAGAGTGcCaTGCCCGAAgGtTATGTACAGGANAGAACTATATTTTTCNNAGATGANNGGNA
CTACNNGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGNTNATANAATCNAGTTAAAANGNATTGATNTTAANG
NAGANGGANACNNNCTNNGACACNNATTGNNATANNACTATNNCTCACACNNNNNATACNTCATGNCANACNAACANNNN
NTNNNNTCAAAGNNNACTNNNNAANNAGACANNNNNNNNNNNGNNNNNTNNNNTNGCNNANNNNNNNNNNNNANNNNNNN
NNNNGNNNNNNNNCNNNCNTTNNNNNAANNNNNTNNNNNGNNCNNNNNNNNNNNNNNNNNNNANNANNCNNNNNAANNNN
NNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNN
NNNNNGNNNNNNTNNNNNNNNNNN

11. QV-3

NNNNNNNNNNNNgtgCCgagaagGcCCACCCGTGAAGGTGAGCCAGTGAGTTGATTGCTACGTAATTAGTTAGTTAGCCC
TTAGTGACTCGAATTCGCGGCCGCTTCTAGAGCTGATGGCTAGCTCAGTCCTAGGGATTATGCTAGCTNCTAGTAGCTAG
NNNNNNNNNNNNNNNNGAGGANNNNTNNNNNATGACCNTGANNNCNGNTTCNNNGGNCNNNGNNNTNNNNNNNCNNGACT
GGGANANNNNNGNCGTTACNNNNNTTANTCNNNTTGCANNGNNNNNCNNTTTNNNCNGNTGGNNNNNNANCGNAGAGGCC
CNNNNNGATCNNCCTTCCCANNNNNTGCNCNNNCTGNNNGGCNANNGNNNCGNGNNNGGNNGNNNNNGCGGNGGNTNCNA
ANNTNNNNNNCNTNNNNNNNGNNNCNNNCNTNAANGANANNANCTTTTCNCTGGANTNNNCNNANTNNNTGNTNANNTNN
ANGGTNNNNNNNNNGGNNNNNNNTNNTNTGTCNNNNNNNANNNNNANNGNNANNNNNNNTNCNGNNNNNNNNCNNNNNNN
NTNNNNNNCNNNNNNGNNNANNNNNNNNNNCCATGNNNNNNNNNNNTCNCTANNNTGANNNANNNNNNNNNNNNNNNNNN
NNNNNANNNNNANCNNNNNNNNNNGCANNNNTNNNNCNNNNNNNNNNNGNNNNANGGTNANNNNNNNGAANGNNNNATCN
NNNTCNNNNNNNNCNNNNNCNNNNNNANNNNNNNNNNNNNCNNNNNNNNNNNNNTACCNNNNNNNNNNNNANCNNNNNNN
ANNNNNTNNNNTNNNNNNNNNNNGNANNCNTNNNNNNNNNNNNNTGNNNNCNGCNNNNNNNNCNCNNNNNNNNNNNNNNN
NNNNNNNANNNNNNNNNNNANNNNNNNNNNANNNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNNNTTTNCCNNNNNNNNNTNNNNNNNNNNNNNNCNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNA
NNNNNNNNNNNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNNNNNNNN

12. QV-4

NNNNNNNNNGNCGtGCCGAgAAGGcCCACCCGTGAAGGTGAGCCAGTGAGTTGATTGCTACGTAATTAGTTAGTTAGCCC
TTAGTGACTCGAATTCGCGGCCGCTTCTAGAGTTGACAGCTAGCTCAGTCCTAGGTATAATGCTAGCTACTAGAGAAAGA
GGAGAAATACTAGATGACCATGATTACGGATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTA
CCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCC
CAACAGTTGCGCAGCCTGAATGGCGAATGGCGCGCGGGCGGCAGCGAAGGCGGCGGCAGCGAACATCATCATCATCATCA
TGGCAGCGAACGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGC
ACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGA
AAACTACCTGTTCCATGGCCAACACTTGTCACTACCCTGACCTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATAT
GAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGA
ACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAA
GAAGATGGAAACATTCTTGGACACAAATTGGNNTACAACTATAACTCACACAATGTATACATCATGGTAGACAACAAAAG
AATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGNAGCGTTCAACTAGCAGACCATTATCANAAAAN
TACTCCNATTGGCGATGGCCCTGGTCCTTTTTNCCAGANNANCATNNNNTGTCCNNNNNAANNNNGCNCNTTTNNNNAGA
NNCNNNNNNNNNNNNCNNNNNGNCCTTNCTNTGANTNNTANNNNCTGNNNNGGNNNNNNCNCANGNGNNNGGNNNNGANC
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNCCNNNNNNNANTNNNNNNNNGGGTNNNNNNTTNNNNTNNNNNNNAANNN
NNNNNNNNNNCNNNNCNNGNGNNTNTNNNNNNNAAANNTNNNNNNNNTNNNNNNNNGGGGGNNNNNNNNNNNNNNNN

13. TS-1

NNNNNNNATTTNNNGTGCcgAgaAGGCCCACCCGTGAAGGTGAGCCAGTGAGTTGATTGCTACGTAATTAGTTAGTTAGC
CCTTAGTGACTCGAATTCGCGGCCGCTTCTAGAGTTGACAGCTAGCTCAGTCCTAGGTATAATGCTAGCTACTAGAGAAA
GAGGAGAAATACTAGATGACCATGATTACGGATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGT
TACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTT
CCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCGCGGGCGGCAGCGAAGGCGGCGGCAGCGAACATCATCATCATCAT
CATGGCAGCGAACGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGG
GCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTG
GAAAACTACCTGTTCCATGGCCAACACTTGTCACTACCCTGACCTATGGTGTTCAATGCTTTGCGAGATACCCAGATCAT
ATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGG
GAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTA
AAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAA
AAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGNAGCGTTCAACTAGCAGANCATTATCAACA
AANACTCCNANNGNGATGGNCCTGTCCTTTTANCNGANANCATTACCTGNCCNNNCNANCTGNNNNNNAANNANNCCCAN
NGAAAANNANAANNCNNNNNGGGNCCNNCNTNNNNNNGTNNNNNCCTGNCNNGNNNTNNNNNNNGGCANGGNNNNNNNNN
NNNNANNNNNNNNNNNNNNNNNCCNCNNNNNNNNNNNNNNGGGNNNNNNNNNNNNTNNNCNNNNNNNAANNCNNCNNNCN
NNGNNNNNTNNNNAANTNCNNTNNGGNNNNNNNNNNTGNGGNNNNNNNNNNNCNNNNNNNNNN

14. TS-2

NNNNNNNNNNNNNNNGTGCCGAAgAAGGCCCACCCGTGAAGGTGAGCCAGTGAGTTGATTGCTACGTAATTAGTTAGTTA
GCCCTTAGTGACTCGAATTCGCGGCCGCTTCTAGAGTTTACGGCTAGCTCAGTCCTAGGTATAGTGCTAGCTACTAGAGA
AAGAGGAGAAATACTAGATGACCATGATTACGGATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGC
GTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCC
TTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCGCGGGCGGCAGCGAAGGCGGCGGCAGCGAACATCATCATCATC
ATCATGGCAGCGAACGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAAT
GGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTAC
TGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACCCTGACCTATGGTGTTCAATGCTTTGCGAGATACCCAGATC
ATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGAC
GGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGNATTGATTT
TAAAGAAGATGGAAACATTCTTGGACACAAATTGGNATACAACTATAACTCACACAATGTATACATCATGGCAGACAAAC
AAAGAATGGNATCAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGNAGCGTTCACTAGCAGANCATTATCANNAA
TACNNNNNNGCGATGGNCCTGTCNTTACNGANNNNTNCTGTCCANNCNANCTGNCNTTCNAANATCCCANNAAANNNNNN
ANCCNCATGNNNNNNTGNNTTGTAACANCNNCNNGNNNNNNCANNGNNNGNNNACNNNNNNANNNNNANTANGNCNNNNN
NNNNNNNNTNNNTNNNNNNNANNNNCNNAANNNNNNNNNNNNNNNNNNNNNNNNNNAANNNNNNNGGNNNNNNNTNNNNN
TNNNNNGGGNGGNNNNNNNCNNNNTNNN

15. TS-3

NNNNNNNNNNNNgtGCCgAgaAGGCCCACCCGTGAAGGTGAGCCAGTGAGTTGATTGCTACGTAATTAGTTAGTTAGCCC
TTAGTGACTCGAATTCGCGGCCGCTTCTAGAGTTTATAGCTAGCTCAGCCCTTGGTACAATGCTAGCTACTAGAGTCACA
CAGGAAAGTACTAGATGACCATGATTACGGATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTT
ACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTC
CCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCGCGGGCGGCAGCGAAGGCGGCGGCAGCGAACATCATCATCATCATC
ATGGCAGCGAACGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGG
CACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGG
AAAACTACCTGTTCCATGGCCAACACTTGTCACTACCCTGACCTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATA
TGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGG
AACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAA
AGAAGATGGAAACATTCTTGGNCACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAA
GAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCANAAAA
TACTCCAATTGGCGATGGNCCTGTCNTTTACCAGANNANCATTACCTGNCCNNNNAATCNNNCCTTCGAANATCCNANNA
AAANANNNNACCNNCNNNNGTCCTNNNTNNANTTGNNNCANCNGCTGGNNTNNNNNNANNNNNGNNNGNACNNTNNNANN
NNNNNNTNNNTNNNANNNNCNCNNNNNNNNNNNNNCNNNNNNNNNNNNNNNNNNNNTANNNNNNNNNNNNNNNNNACNNA
GNNNTNNANTNANTNNNCNNNGNNNNTNNNNNTNTNGGGNGNNNTNNN

16. TS-4

NNNNNNNATTTGCCGTGCCGAgAAGGcCCACCCGTGAAGGTGAGCCAGTGAGTTGATTGCTACGTAATTAGTTAGTTAGC
CCTTAGTGACTCGAATTCGCGGCCGCTTCTAGAGTTGACAGCTAGCTCAGTCCTAGGTATAATGCTAGCTACTAGAGTCA
CACAGGAAAGTACTAGCCATGATTACGGATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTAC
CCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCC
AACAGTTGCGCAGCCTGAATGGCGAATGGCGCGCGGGCGGCAGCGAAGGCGGCGGCAGCGAACATCATCATCATCATCAT
GGCAGCGAACGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCA
CAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAA
AACTACCTGTTCCATGGCCAACACTTGTCACTACCCTGACCTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATG
AAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAA
CTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAG
AAGATGGAAACATTCTTGGACACAAATTGGNATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAGA
ATGGNATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCACTAGCAGACCATTATCANAAATACT
CCNATTGGCGATGGNCCTGTCCTTTTACANANNNNTTACNGTCCNCNCNATCTNNNTTTCGAAANANNCNACGAAAANNN
NNNACCNCATGGNCNNNNNTNNNNNNNTAANANCNNNCNNNNNTNNNNNNTGGGCNNGNNNNANCNNTNNNNNNANNNNN
NNNNNNNNNNCNNNTNCNGNNNTNNNNNNNNNNGNTNNNNNNNNNNTNNNNNNNNAANNNNANNNNNNNCNNNCNNNNNG
NNNNNNNNANNANNTNNNNNTNNGGNNTNNNNNNNNNTN