SBB11Ntbk-NikitPatel
From OpenWetWare
Jump to navigationJump to search
Constructing Basic Parts
Nikit Patel 11:30, 15 February 2011 (EST)
Thought of the day: Did my first PCR after 3 years at Berkeley!
- Create 100uM stock of oligos: P_sbp_inR and SS50r
- Followed Cloning by PCR Protocol:
- - Used construction files below to setup PCR
- - Did first part of SOEing for P_sbp basic part
- - Thermocycler Program: 2K55
Construction of P_sbp BglBrick basic part sbb1124
PCR ss50f/P_sbp_inR on MG1655 (247 bp, gp = A)
PCR P_sbp_inF/ss50r on MG1655 (492 bp, gp = B)
---------------------------------------------------
PCR ss50f/ss50r on A+B (710 bp, EcoRI/BamHI)
Sub into pBjh1601KC-Bca1144 (EcoRI/BamHI, 3131+910, L)
Product is pBjh1601KC-sbb1124 {P_sbp}
---------------------------------------------------
P_sbp_inR Reverse removal of EcoRI site in P_sbp
CAATAAATTGCAGAAGTCATGTAGGCCTG
P_sbp_inF Forward removal of EcoRI site in P_sbp
CAGGCCTACATGACTTCTGCAATTTATTG
ss50f sbp
aaaccGAATTCatgAGATCTgcggtcgttgtgtaggtatccag
ss50r sbp
tttggGGATCCcaacatcagcttcaataccgttg
Part sbb1104 {P_fadL}
PCR ss29f/ss29r on MG1655 gen. (611bp, EcoRI/BamHI)
Sub into pBjh1601KC-Bca1144#5 (EcoRI/BamHI, 3131+910, L)
Product is pBjh1601KC-sbb1104 {P_fadL}
---------------------------------------------------
ss29fForward Cloning of P_fadL aaaccGAATTCatgAGATCTgctttttcagtcagcgccgccag
ss29rReverse Cloning of P_fadL tttggGGATCCgataagtgccactgcgactgcgagagc
Nikit Patel 12:35, 17 February 2011 (EST)
Thought of the day: Is it me or is ADB buffer like magic? It annihilated the gel so fast!
- P_sbp Products A and B
- - Ran preparative gel
- - Lanes 2 and 3 from gel (below) confirmed sizes around 250 and 500 bp respectively
- - Bands were cut
- - Performed Zymo Gel Purification on both A + B
- - Setup and run PCR for SOEing using Zymo Gel Purified DNA as template. (Used 2K55 mode for thermocycler)
- P_fadL Products
- - Ran analytical gel (prepped 2uL DNA + 5uL Dye)
- - Band in lane 2 from gel (below) confirmed size around 600 bp
- - Perform Regular Zymo Cleanup

Nikit Patel 18:17, 18 February 2011 (EST)
Thought of the day: Nikit + Gary = Best SOEing partners!
- P_sbp SOEing PCR products
- - Ran analytical gel
- - Lane 2 from gel (below) confirmed size around 750 bp. (SOEing worked!)
- - Performed Regular Zymo Cleanup

Nikit Patel 14:29, 22 February 2011 (EST)
Thought of the day: Shout out to Professor Anderson for redoing our PCRs. We will never forget this.
- PCRs were redone. Analytical Gel Lane 14 (below) confirms successful PCR product
- P_sbp (Part sbb1124)
- P_fadL (Part sbb1104)
- - Performed EcoRI/BamHI Digest
- - Digest run for 1 hour in thermocycler
- - Run preparative gel (below)
- - Added 600 uL of ADB buffer to Lane 5 band

Nikit Patel 13:48, 24 February 2011 (EST)
Thought of the day: It's Vini's birthday today! I also found out that Gary is a funny guy.
- P_sbp (Part sbb1124)
- - Gels were cut and loaded with ADB buffer by Professor Anderson the day before
- - Performed EcoRI/BamHI Digest
- - Digest run for 1 hour in thermocycler
- - Ran preparative gel. Lane 1 is my band! (below)
- - Performed rest of Zymo Gel Purification
- - Labelled as "sbb1124 Cut and Cleaned"

- P_fadL (Part sbb1104)
- - Performed rest of Zymo Gel Purification
- - Eluted in 8 uL of water
- - Labelled as "sbb1104 Cut and Cleaned"
Nikit Patel 14:59, 1 March 2011 (EST)
Thought of the day: Sad that UCB Ph.D candidates are visiting today and I'm not one of them.
- Performed ligation reaction on both parts
- - Used pBjh1601KC-Bca1144 vectors for both
- - Incubated on bench top for 30 minutes
- Performed transformation by heat-shock on ligation products
- - Shared cells with Gary
- - Heat shocked for 120 seconds
Nikit Patel 3:44, 3 March 2011 (EST)
Thought of the day: Marcus was acting really hyper during lab. It was entertaining!"
- Plate had many colonies.
- Four colonies were picked from each plate for us
- Performed Miniprep Purification on the 8 cultures
Nikit Patel 13:37, 8 March 2011 (EST)
Thought of the day: I want Sergey to add me on Words with Friends!
- Performed Analytical Mapping Digests on all 8 minipreps
- Ran the digested products on a gel (below)
- - Lane #5 : sbb1104 #1
- - Lane #6 : sbb1104 #2
- - Lane #7 : sbb1104 #3
- - Lane #8 : sbb1104 #4
- - Lane #9 : sbb1124 #1
- - Lane #10 : sbb1124 #2
- - Lane #11 : sbb1124 #3
- - Lane #12 : sbb1124 #4
Nikit Patel 13:00, 10 March 2011 (EST)
Thought of the day: BioE 100 midterm is stealing my mind away from BioE 140L midterm!
- Lane 11 doesn't look good.
- Therefore, we will be putting in sbb1104 #1/2 and sbb1124 #1/2 for sequencing