SBB09 Construct47
From OpenWetWare
Jump to navigationJump to search
1) Native C-terminal portion of ompX {N.ompX}
PCR Ovu015/Ovu016 on MG1655 gen. (322bp, EcoRI/BamHI)
Sub into pBca9145-Bca1144#5 (EcoRI/BamHI, L)
Product is pBca9145-M10012 {N.cpx}
-----------------------------------------------------------
Ovu015 Construction of OmpX N term part
ctagaGAATTCatgAGATCTGGTCAGTCTggtgactacaacaaaaaccag
Ovu016 Construction of OmpX N term part
gacaaGGATCCgaagcggtaaccaacagaggcaatccaggtgcctac
2) Native N-terminal portion of ompX {C.ompX}
PCR Ovu017/Ovu018 on MG1655 gen. (196bp, EcoRI/BamHI)
Sub into pBca9145-Bca1144#5 (EcoRI/BamHI, L)
Product is pBca9145-M10013 {C.cpx}
-----------------------------------------------------------
Ovu017 Construction of OmpX C term part
ctagaGAATTCatgAGATCTgcgacttctactgtaactgg
Ovu018 Construction of OmpX C term part
gacaaGGATCCttaagagcttgcagtacggcttttctcgg
3) SOEing assembly of eCPX
PCR Ovu015/Ovu019 on pBca9145-M10012 (334bp, EcoRI/BamHI = A)
PCR Ovu020/Ovu018 on pBca9145-M10013 (194bp, EcoRI/BamHI = B)
PCR Ovu015/Ovu018 on A+B (505bp, EcoRI/BamHI)
Sub into pBca9145-Bca1144#5 (EcoRI/BamHI, L)
Product is pBca9495KC-M10014 {<eCPX!}
-----------------------------------------------------------
Ovu019 SOEing of eCPX
gtcgcTTTAGACTGTTTAGATCCgaagcggtaaccaacag
Ovu020 SOEing of eCPX
GGATCTAAACAGTCTAAAgcgacttctactgtaactgg
Criteria for Linker between N and C terminus:
From the paper, I was able to extract the following information:
- The linker should be 6 peptides long
- The first peptide should be Glycine
- The third and sixth positions were restricted to R/K/S/H/Q/N
- The substitution A165V resulted in improved display scaffolds
- The substitution G166S resulted in improved display scaffolds
- The display enhancing substitutions A165V and G166S are located immediately upstream of the native C-terminus of OmpX
- The remaining positions (2 and 4) should be randomized
keeping all this in mind I thought the following linker would be best suited: GSKNVS
which has a nucleotide sequence of: GGTTCTAAAAATGTTTCT
New N junction gttggttaccgcttc
New C junction aaaaaaattgcatgtctttc
Forward Oligo:
Linker.C junction GGTTCTAAAAATGTTTCTaaaaaaattgcatgtctttc
Reverse Oligo:
N junction.Linker gttggttaccgcttcGGTTCTAAAAATGTTTCT
Reverse Complement: AGAAACATTTTTAGAACCgaagcggtaaccaac
Note: VU021F had to be used instead of re-using VU017 because VU017 was used to construct {C.OmpX>} through EIPCR