SBB09 Construct47

1) Native C-terminal portion of ompX {N.ompX}

PCR Ovu015/Ovu016 on MG1655 gen.          (322bp, EcoRI/BamHI)
Sub into pBca9145-Bca1144#5               (EcoRI/BamHI, L)
Product is pBca9145-M10012	{N.cpx}
-----------------------------------------------------------
Ovu015	Construction of OmpX N term part	
ctagaGAATTCatgAGATCTGGTCAGTCTggtgactacaacaaaaaccag
Ovu016	Construction of OmpX N term part	
gacaaGGATCCgaagcggtaaccaacagaggcaatccaggtgcctac

2) Native N-terminal portion of ompX {C.ompX}

PCR Ovu017/Ovu018 on MG1655 gen.          (196bp, EcoRI/BamHI)
Sub into pBca9145-Bca1144#5               (EcoRI/BamHI, L)
Product is pBca9145-M10013	{C.cpx}
-----------------------------------------------------------
Ovu017	Construction of OmpX C term part	
ctagaGAATTCatgAGATCTgcgacttctactgtaactgg
Ovu018	Construction of OmpX C term part	
gacaaGGATCCttaagagcttgcagtacggcttttctcgg	

3) SOEing assembly of eCPX

PCR Ovu015/Ovu019 on pBca9145-M10012        (334bp, EcoRI/BamHI = A)
PCR Ovu020/Ovu018 on pBca9145-M10013        (194bp, EcoRI/BamHI = B)
PCR Ovu015/Ovu018 on A+B                    (505bp, EcoRI/BamHI)
Sub into pBca9145-Bca1144#5               (EcoRI/BamHI, L)
Product is pBca9495KC-M10014	{<eCPX!}
-----------------------------------------------------------
Ovu019	SOEing of eCPX	
gtcgcTTTAGACTGTTTAGATCCgaagcggtaaccaacag
Ovu020	SOEing of eCPX	
GGATCTAAACAGTCTAAAgcgacttctactgtaactgg			

---

Criteria for Linker between N and C terminus:

From the paper, I was able to extract the following information:

• The linker should be 6 peptides long
• The first peptide should be Glycine
• The third and sixth positions were restricted to R/K/S/H/Q/N
• The substitution A165V resulted in improved display scaffolds
• The substitution G166S resulted in improved display scaffolds
• The display enhancing substitutions A165V and G166S are located immediately upstream of the native C-terminus of OmpX
• The remaining positions (2 and 4) should be randomized

keeping all this in mind I thought the following linker would be best suited: GSKNVS

which has a nucleotide sequence of: GGTTCTAAAAATGTTTCT

New N junction gttggttaccgcttc

New C junction aaaaaaattgcatgtctttc

Forward Oligo:

Linker.C junction GGTTCTAAAAATGTTTCTaaaaaaattgcatgtctttc

Reverse Oligo:

N junction.Linker gttggttaccgcttcGGTTCTAAAAATGTTTCT

Reverse Complement: AGAAACATTTTTAGAACCgaagcggtaaccaac

Note: VU021F had to be used instead of re-using VU017 because VU017 was used to construct {C.OmpX>} through EIPCR