SBB09 Construct12

From OpenWetWare
Jump to navigationJump to search

Construction of Ice Nucleation Protein

 PCR Odd003F/BBa_G00101 on pBca1256-Bca1346		(3722 bp, EcoRI/BamHI)
 Sub into pBca9495CA-Bca1144#5				(EcoRI/BamHI, 3039+910 bp, L)
 Product is pBca9495CA-M10041				{a~INP>} 
 Odd003F	Forward oligo for INP			ccaaaGAATTCatgAGATCTtgtaATGaatctcgacaaggcg
 BBa_G00101 	Reverse sequencing of pSB1A* plasmids	attaccgcctttgagtgagc