Registry/Measurement kit/Notebook/2007-6-20

To Do

1. Add new devices into the Registry
2. Check re-plating of devices A and C (done. no growth.)
3. Create/order primers for device B
4. Mini-prep and sequence device B culture (colony 8) and Jason's three cultures (done)

Mini-Prep

• Spun at 5k for 4.5 min before prepping
• note: accidentally added 250 of P1 to each tube instead of each culture, but reconsolidated into four miniprep columns. We'll see if this affects the results drastically.
• Eluted with 30µL of EB.
• For future reference: when sequencing, should elute with aqueous NaOH solution of pH 8.5
  • Will probably need to re-do this...

"Device B" Primers

• Fwd
  • CTTAGTAG + CAATTG + tccctatcagtgatagagattgacatc
• Rev
  • TCAGCGAT + ATGCAT + TATAAACGCAGAAAGGCCCAC

Tm ~53 deg