Recombination into the Viral Genome

From OpenWetWare
Jump to: navigation, search

DNA Sequencing

Once we’ve screened our clones by colony PCR to verify that they contain an insert of the correct size, we need to sequence the inserts to verify that the gene does not contain any sequence errors.

Sanger sequencing: The DNA is sequenced using chain termination sequencing (also called Sanger or cycle sequencing). Information on cycle sequencing and how it works can be found here: http://www.dnalc.org/view/15923-Cycle-sequencing.html and http://www.nature.com/scitable/topicpage/the-order-of-nucleotides-in-a-gene-6525806.

When sequencing data is sent to us, we receive not only a text file containing the sequence of the DNA insert, but we also receive the data from the sequencing machine in the form of a color-coded electropherogram. The electopherogram represents the data obtained from sequencing detector, with the height of each peak representing the strength of the signal. We can therefore see the quality of the sequencing data that was obtained as well as investigate any ambiguities in the sequence.
You will notice that the signal at the end of the electropherogram is not as strong as at the beginning; the peaks are much shorter and broader and become difficult to distinguish from one another. This is due to the difficulty of discriminating between relatively long DNA sequences at single-nucleotide resolution.

Comparing the sequencing read to the desired sequence:

Now we need to determine if our clones contain a sequence that perfectly matches Gene 68 and promoter or if they have DNA sequence errors. To accomplish this, we a bioinformatics tool called ClustalW: http://www.ebi.ac.uk/Tools/msa/clustalw2/.

1. Under "Step 1" of ClustalW, change the settings from Protein to DNA.
2. Input the sequence of Gene 68. The line before the sequence must contain >Gene68 (no spaces).

>Gene68
ATGCCTAGCGCGAAGGCGATTGCCGCCGTGGCCAACGACCAACGCTGGCGGAAGCAAGCTGTCTGTCATCCGGCGCGCGGCCACAACCCCGAAATCTGGTTCCCGCCGACCCCGCGCCCGTACGCCACCCGCGCCGAGGCCCGCGAGGCCACCGCCATCCGCCTGCAGTGGGAGTCGGAGGCCAAGGCCCTGTGCGCCCAGTGCCCGGTGCGCCTGGAGTGCCTGGAGTACGCCAACGACAACGACGAGCGCGAGGGCATCTGGGGCGGCCTGACCGTGACCGAGCGCGGCCTGACCCCGCTGCGCTAACCCAACTCACAGAACAGGTTCCGAACAATGTCACGACACAACGCACGCACCGCCGACCCGGCCACATCGCACCGCGCGGCTCGCGCCAACCGCGGATCCCGACAGTCACACAAACGT

3. Skip a line and input the sequencing reaction:

>Gene68.sequence1
CGNANTCANNGGGNAAAGGCCNNTTTTGGANNNNNGACTNGGCCGGCTNGGNTNNCGGAN
CNNTATCAGGACNNNNNNTTGGCTACCCGTGATANTNNTGAAGAACTGNGCGGCGAATGG
GCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTC
TATCGCCTTCTTGACGAGTTCTTCTGACTGTCAGACCAAGTTTACTCATATATACTTTAG
ATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAAT
CTCATGACCAAAATTTAATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGG
GGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGT
AAAACGACGGCCAGTGAGCGCGCGTAATACGACTCACTATAGGGCGAATTGGAGCTCCCG
CGGTGCGGCCGCTCTAGAACTAGTGGATCCCCCGGGCTGCAGCGACCAATGTGGAATTCG
CCCTTATGCCTAGCGCGAAGGCGATTGCCGCCGTGGCCAACGACCAACGCTGGCGGAAGC
AAGCTGTCTGTCATCCGGCGCGCGGCCACAACCCCGAAATCTGGTTCCCGCCGACCCCGC
GCCCGTACGCCACCCGCGCCGAGGCCCGCGAGGCCACCGCCATCCGCCTGCAGTGGGAGT
CGGAGGCCAAGGCCCTGTGCGCCCAGTGCCCGGTGCGCCTGGAGTGCCTGGAGTACGCCA
ACGACAACGACGAGCGCGAGGGCATCTGGGGCGGCCTGACCGTGACCGAGCGCGGCCTGA
CCCCGCTGCGCTAACCCAACTCACAGAACAGGTTCCGAACAATGTCACGACACAACGCAC
GCACCGCCGACCCGGCCACATCGCACCGCGCGGCTCGCGCCAACCGCGGATCCCGACAGT
AACACAAACGTAAGGGCGAATTCCACAGTGGATATCAAGCTTATCGATACCGTCGACCTC
GA

4. Click Align.

Clustal W gives you a scores table indicating the pairwise alignment similarity score (out of 100). More importantly, it provides a DNA alignment. Residues that are identical in the two sequences marked with a *. Note that the alignment extends past the end of the gene and continues to sequence the vector as well. Determine whether your sequence is identical to the desired sequence.

5. Repeat analysis for the remaining clones.

Click the back arrow on ClustalW to return to Step 1 where you input your sequences. Keep the reference sequence (Gene68), but replace the sequencing reaction with one of the three reactions below. Align the sequences, analyze and repeat for all the reactions.

>Gene68.sequence2
TTNCGAATTCATNGGGNNAANGNCNNNNTTNGANTNNCGACTNGGCCGGCTNGGTTNGNN
GACCGCTATCAGGACATAGCNNTGGCTACCCGTGATNNTGCTGAAGAACTGNGCGGCGAA
TGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCC
TTCTATCGCCTTCTTGACGAGTTCTTCTGACTGTCAGACCAAGTTTACTCATATATACTT
TAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGAT
AATCTCATGACCAAAATTTAATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAA
GGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGT
TGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACTCACTATAGGGCGAATTGGAGCTC
CCGCGGTGCGGCCGCTCTAGAACTAGTGGATCCCCCGGGCTGCAGCGACCAATGTGGAAT
TCGCCCTTATGCCTAGCGCGAAGGCGATTGCCGCCGTGGCCAACGACCAACGCTGGCGGA
AGCAAGCTGTCTGTCATCCGGCGCGCGGCCACAACCCCGAAATCTGGTTCCCGCCGACCC
CGCGCCCGTACGCCACCCGCGCCGAGGCCCGCGAGGCCACCGCCATCCGCCTGCAGTGGG
AGTCGGAGGCCAAGGCCCTGTGCGCCCAGTGCCCGGTGCGCCTGGAGTGCCTGGAGTACG
CCAACGACAACGACGAGCGCGAGGGCATCTGGGGCGGCCTGACCGTGACCGAGCGCGGCC
TGACCCCGCTGCGCTAACCCAACTCACAGAACAGGTTCCGAACAATGTCACGACACAACG
CACGCACCGCCGACCCGGCCACATCGCACCGCGCGGCTCGCGCCAACCGCGGATCCCGAC
AGTCACACAAACGTAAGGGCGAATTCCACAGTGGATATCAAGCTTATCGATACCGTCGAC
CTCGANGGNG
>Gene68.sequence3
AATNGNCGCNTTTCNGGATTCATCGACTGTGNCNGCTNGGNNGGGCNNNNCGCTATCAGG
ACATAGCGTTGGCTACCCGNGATATTGCTGAAGAACTTGGCGGCGAATNGGCTGACCGCT
TCCTCGNNCTTTACGGTATGNCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTC
TTGACGAGTTCTTCTGACTGTCAGACCAANTTTACTCATATATACTTTAGATTGATTTAA
AACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCA
AAATTTAATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAANNNGGATGTGCTG
CAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGG
CCAGTGAGCGCGCGTAATACGACTCACTATAGGGCGAATTGGAGCTCCCGCGGTGCGGCC
GCTCTAGAACTAGTGGATCCCCCGGGCTGCAGCGACCAATGTGGAATTCGCCCTTATGCC
TAGCGCGAAGGCGATTGCCGCCGTGGCCAACGACCAACGCTGGCGGAAGCAAGCTGTCTG
TCATCCGGCGCGCGGCCACAACCCCGAAATCTGGTTCCCGCCGACCCCGCGCCCGTACGC
CACCCGCGCCGAGGCCCGCGAGGCCACCGCCATCCGCCTGCAGTGGGAGTCGGAGGCCAA
GGCCCTGTGCGCCCAGTGCCCGGNGCGCCTGGAGTGCCTGGAGTACGCCAACGACAACGA
CGAGCGCGAGGGCATCTGGGGCGGCCTGACCGTGACCGAGCGCGGCCTGACCCCGCTGNN
CTAACCCAACTCACAGAACAGGTTCCGAACAATGTCACGACACAACGCACGCACCGCCGA
CCCGGCCACATCGCACCGCGCGGCTCGCGCCAACCGCGGATCCCGACAAAGGGCGAATTC
CACAGTGGATATCAAGCTTATNCGATACCNTCNGA
>Gene68.sequence4
TATCAGGACATAGCGTTGG
CTACCCGTGATATTGCTGAAGAACTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTT
ACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCT
TCTGACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTT
AATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATTTAATCGG
TGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAA
GTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAGCGCG
CGTAATACGACTCACTATAGGGCGAATTGGAGCTCCCGCGGTGCGGCCGCTCTAGAACTA
GTGGATCCCCCGGGCTGCAGCGACCAATGTGGAATTCGCCCTTATGCCTAGCGCGAAGGC
GATTGCCGCCGTGGCCAACGACCAACGCTGGCGGAAGCAAGCTGTCTGTCATCCGGCGCG
CGGCCACAACCCCGAAATCTGGTTCCCGCCGACCCCGCGCCCGTACGCCACCCGCGCCGA
GGCCCGCGAGGCCACCGCCATCCGCCTGCAGTGGGAGTCGGAGGCCAAGGCCCTGTGCGC
CCAGTGCCCGGTGCGCCTGGAGTGCCTGGAGTACGCCAACGACAACGACGAGCGCGAGGG
CATCTGGGGCGGCCTGACCGTGACCGAGCGCGGCCTGACCCCGCTGCGCTAACCCAACTC
ACAGAACAGGTTCCGAACAATGTCACGACACAACGCACGCACCGCCGACCCGGCCACATC
GCACCGCGCGGCTCGCGCCAACCGCGGATCCCGACAGTCACACAAACGTAAGGGCGAATT
CCACAGTGGATATCAAGCTTATCGATACCGTCGACCTCGANGGGG


PCR Purification

Before we can introduce the synthetic gene 68 DNA into bacteria, we must remove the buffer used for PCR. Our technique for introducing the DNA into cells uses a pulse of electricity, and any leftover buffer (salts) would affect this process. We can remove the old buffers and proteins using the Wizard SV PCR Clean-Up System.

1. Obtain 100 ul of PCR product.
2. Add 100 ul of Membrane Binding Solution and mix well.
3. Add the liquid to the top of a column
4. Spin in centrifuge for 1 min and pour out liquid from the bottom
5. Add 700 ul membrane wash solution to the top of the column
6. Spin in centrifuge for 1 min and pour out liquid from the bottom
7. Add 500 ul membrane wash solution to the top of the column
8. Spin in centrifuge for 5 min and pour out liquid from the bottom
9. Spin in centrifuge for 1 min
10. Discard the bottom collection tube and transfer the column to a new microcentrifuge tube
11. Add 50 ul of Nuclease Free water to the column. Wait 1 min. Spin in centrifuge for 1 min. Throw out column and keep the liquid in the bottom, which is your purified DNA.


Transformation of Bacteria with Phage DNA

Now that we have created synthetic Gene 68, we need to combine that synthetic gene with the rest of the phage genome. We will do this by combining the native phage genome with the synthetic gene 68 inside the host cell (the bacteria Mycobacterium smegmatis). Within the bacterial cell, the native phage genome and the synthetic gene 68 will undergo the process of recombination, which will join them into a semi-synthetic phage genome.

If it is infectious, the semi-synthetic phage genome will burst the initial host bacterial cell, causing it to rupture and release phages which will then infect neighboring bacterial cells. These neighboring cells will then be ruptured, and the process will repeat, resulting in the formation of a plaque, a region where all of the bacterial cells have been burst.

Today we will introduce the native phage genome and synthetic gene 68 into the bacterial cells and then plate those cells onto a petri dish. If the semi-synthetic phage that is formed is infectious, we will see plaques on the petri dishes next week. The method that we will use to introduce the phage genome and synthetic gene into bacteria is called electroporation; rather than using heat to get the DNA into the bacteria (as we did a few weeks ago), we will use a short pulse of electricity.

Electroporation:

1. Label two tubes (+DNA and -DNA) and place them on ice so that they become cold.
2. Once the cells have thawed, transfer 100 ul of cells to each of the two empty tubes.
3. To the first tube (+DNA), add 1 ul of the phage DNA and 3 ul of synthetic gene 68. To the second tube (-DNA), add 4 ul of water. Incubate on ice for 10 min.
5. During the 10 min incubation:

     •Obtain 2 cuvettes and place on ice so that they become cold. 
•Obtain two tubes of 7H9 media
•Obtain two Pasteur pipettes

6. After the 10 min incubation:

     •Transfer the DNA and cells from the first tube into the first cuvette (on ice!)
•Wipe the cuvette with a Kimwipe to remove any wetness
•Transfer the cuvette into the black cuvette holder and insert into electroporation machine
•Press the PULSE button twice to deliver the pulse of electricity
•Pick up the Pasteur pipette with liquid. As soon as the machine beeps, pull out the cuvette holder and immediately add the 7H9 media on top of the cells
•Transfer the mixture of 7H9 media and cells to a glass test tube and place in 37 degree incubator for 1 hour

7. 15 minutes before the incubation is done, prepare the top agar. Melt the MBTA (Middlebrook top agar) in the microwave until just melted and allow to cool for 10 min.
8. Once the one hour incubation time is done, add the following to each of the glass test tubes (add in the order listed):

     •300 ul of Mycobacteria smegmatis cells
•1.5 ml 7H9 media
•2.5 ml MBTA

9. Vortex gently and pour the mixture into a petri dish. Swirl gently to distribute the mixture evenly in the plate. Allow to cool for ~10 minutes and then incubate at 37 degrees.