
From OpenWetWare
Jump to navigationJump to search

Pete Davenport's Primers

PA01 primers
Primer sequence PA01 genome position (1st base 3`) +/- strand 5`of 5` mods e.g. "RE" "stuffer" "restriction site" Tm (Sigma)
on3 AAGGTACCAGGATTGGCTTATCCCGAAG 1559025 + lasI KpnI aa ggtacc
on4 AAGAGCTCGTCCGGGGATGCCTGATAG 1559962 - lasI SacI aa gagctc
on5 AATCTAGAGATGGTCGAACTGGTCGAAT 3889608 + rhlR XbaI aa tctaga
on9 AAGGTACCGGAACCAACTGTTCCAGCAT 2068690 + qscR KpnI aa ggtacc
on10 AAGAGCTCATTGCCATGACCGAATGTTT 2070518 - qscR SacI aa gagctc
on11 GGTATCGCGGTGAAGATGAT + lasR, on1 63.8
on12 GCCTGCTGCTCTATTTCCAG - lasI, on4 63.9
on13 TATTCGAGCCAGTGCTCCAT + rhlI, on7 64.6
on14 GGTACACCCCAAGTTCAACG - rhlR, on6 64.1
on15 AGCAGCGAGTTGAAGACCAT + qscR, on9 63.9
on16 CTCGAAGATCCGCACGTT - qscR, on10 64.1
on18 aaggatccATGTTTTGGGGCTGTGTTCT + lasI BamHI aa ggatcc
on19 aagtcgacGTCCGGGGATGCCTGATAG - lasI SalI aa gtcgac
on20 aaggatccGCAGAGAGACTACGCAAGTCG + rhlI BamHI aa ggatcc

notes: "5`of" - what is the first gene or other tagged identified sequence (on either strand) in the 3` direction from the primer