PSW23t

From OpenWetWare
Jump to: navigation, search

>pSW23t gi|52353984|gb|AY733066.1| Cloning vector pSW23T, complete sequence CAATTGATATCGCGCGCGTAATACGACTCACTATAGGGCGAATTGGGTAC CAGCGCTTTTCCGCTGCATAACCCTGCTTCGGGGTCATTATAGCGATTTT TTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGG TTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATA GGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTA TTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGG CGTCGACGGTATCGATAAGCTTGATATCGAATTCCTGCAGCCCGGGGGAT CCACTAGTTCTAGAGCGGCCGCCACCGCGGTGGAGCTCCAGCTTTTGTTC CCTTTAGTGAGGGTTAATTGCGCGCAATTCCCATGTCAGCCGTTAAGTGT TCCTGTGTCACTCAAAATTGCTTTGAGAGGCTCTAAGGGCTTCTCAGTGC GTTACATCCCTGGCTTGTTGTCCACAACCGTTAAACCTTAAAAGCTTTAA AAGCCTTATATATTCTTTTTTTTCTTATAAAACTTAAAACCTTAGAGGCT ATTTAAGTTGCTGATTTATATTAATTTTATTGTTCAAACATGAGAGCTTA GTACGTGAAACATGAGAGCTTAGTACGTTAGCCATGAGAGCTTAGTACGT TAGCCATGAGGGTTTAGTTCGTTAAACATGAGAGCTTAGTACGTTAAACA TGAGAGCTTAGTACGTGAAACATGAGAGCTTAGTACGTACTATCAACAGG TTGAACTGCTGATCTTCAGATCCTCTACGCCGGACGCATCGTGGCCGGAT CAGATCTGATATCGTCGCAGACCAAAACGATCTCAAGAAGATCATCTTAT TAATCAGATAAAATATTTCTAGGCACCAATAACTGCCTTAAAAAAATTAC GCCCCGCCCTGCCACTCATCGCAGTACTGTTGTAATTCATTAAGCATTCT GCCGACATGGAAGCCATCACAAACGGCATGATGAACCTGAATCGCCAGCG GCATCAGCACCTTGTCGCCTTGCGTATAATATTTGCCCATGGTGAAAACG GGGGCGAAGAAGTTGTCCATATTGGCCACGTTTAAATCAAAACTGGTGAA ACTCACCCAGGGATTGGCTGAGACGAAAAACATATTCTCAATAAACCCTT TAGGGAAATAGGCCAGGTTTTCACCGTAACACGCCACATCTTGCGAATAT ATGTGTAGAAACTGCCGGAAATCGTCGTGGTATTCACTCCAGAGCGATGA AAACGTTTCAGTTTGCTCATGGAAAACGGTGTAACAAGGGTGAACACTAT CCCATATCACCAGCTCACCGTCTTTCATTGCCATACGAAATTCCGGATGA GCATTCATCAGGCGGGCAAGAATGTGAATAAAGGCCGGATAAAACTTGTG CTTATTTTTCTTTACGGTCTTTAAAAAGGCCGTAATATCCAGCTGAACGG TCTGGTTATAGGTACATTGAGCAACTGACTGAAATGCCTCAAAATGTTCT TTACGATGCCATTGGGATATATCAACGGTGGTATATCCAGTGATTTTTTT CTCCATTTTAGCTTCCTTAGCTCCTGAAAATCTCGATAACTCAAAAAATA CGCCCGGTAGTGATCTTATTTCATTATGGTGAAAGTTGGAACCTCTTACG TGCCGATCAACGTCTCATTTTCGCCAAAAGTTGGCCCAGGGCTTCCCGGT ATCAACAGGGACACCAGGATTTATTTATTCTGCGAAGTGATCTTCCGTCA CAGGTATTTATTCGGCG