From OpenWetWare
Jump to: navigation, search

pPLAT 2145 bp (circular)

Description: 77-136 MCS (BamHI-PstI-EcoRI-XhoI-HindIII-SacI-XbaI) 342-1009 pUC or i (high copy in E. coli) 1157-2017 (complement) bla--ampicillin resistance) 2059-2087 bl a promoter

CTGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGT GGTTACGCGCAGCGTGACCGCTACACTTGCCAGggatccAGCc tgcagCGCgaattcCGCctcgagCGCaagcttCGCgagctcCG CtctagaCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATG AATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGC TCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTC GGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACG GTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGtga gcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgt tgctggcgtttttccataggctccgcccccctgacgagcatca caaaaatcgacgctcaagtcagaggtggcgaaacccgacagga ctataaagataccaggcgtttccccctggaagctccctcgtgc gctctcctgttccgaccctgccgcttaccggatacctgtccgc ctttctcccttcgggaagcgtggcgctttctcatagctcacgc tgtaggtatctcagttcggtgtaggtcgttcgctccaagctgg gctgtgtgcacgaaccccccgttcagcccgaccgctgcgcctt atccggtaactatcgtcttgagtccaacccggtaagacacgac ttatcgccactggcagcagccactggtaacaggattagcagag cgaggtatgtaggcggtgctacagagttcttgaagtggtggcc taactacggctacactagaaggacagtatttggtatctgcgct ctgctgaagccagttaccttcggaaaaagagttggtagctctt gatccggcaaacaaaccaccgctggtagcggtggtttttttgt ttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaa gatcctttgatcttttctacGGGGTCTGACGCTCAGTGGAACG AAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAG GATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAA TCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGttacc aatgcttaatcagtgaggcacctatctcagcgatctgtctatt tcgttcatccatagttgcctgactccccgtcgtgtagataact acgatacgggagggcttaccatctggccccagtgctgcaatga taccgcgagacccacgctcaccggctccagatttatcagcaat aaaccagccagccggaagggccgagcgcagaagtggtcctgca actttatccgcctccatccagtctattaattgttgccgggaag ctagagtaagtagttcgccagttaatagtttgcgcaacgttgt tgccattgctacaggcatcgtggtgtcacgctcgtcgtttggt atggcttcattcagctccggttcccaacgatcaaggcgagtta catgatcccccatgttgtgcaaaaaagcggttagctccttcgg tcctccgatcgttgtcagaagtaagttggccgcagtgttatca ctcatggttatggcagcactgcataattctcttactgtcatgc catccgtaagatgcttttctgtgactggtgagtactcaaccaa gtcattctgagaatagtgtatgcggcgaccgagttgctcttgc ccggcgtcaatacgggataataccgcgccacatagcagaactt taaaagtgctcatcattggaaaacgttcttcggggcgaaaact ctcaaggatcttaccgctgttgagatccagttcgatgtaaccc actcgtgcacccaactgatcttcagcatcttttactttcacca gcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaa aaagggaataagggcgacacggaaatgttgaatactcatACTC TTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTattgtc TCATGAGCGGATACATAtttgaaTGTATTTAGAAAAATAAACA AATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCAC