New sequence

From OpenWetWare
Jump to: navigation, search

Here is the sequence for Cre in the griffitts plasmid pJG125: CRE ORF IN 125

atgTCCAATTTACTGACCGTACACCAAAATTTGCCTGCATTACCGGTCGA TGCAACGAGTGATGAGGTTCGCAAGAACCTGATGGACATGTTCAGGGATC GCCAGGCGTTTTCTGAGCATACCTGGAAAATGCTTCTGTCCGTTTGCCGG TCGTGGGCGGCATGGTGCAAGTTGAATAACCGGAAATGGTTTCCCGCAGA ACCTGAAGATGTTCGCGATTATCTTCTATATCTTCAGGCGCGCGGTCTGG CAGTAAAAACTATCCAGCAACATTTGGGCCAGCTAAACATGCTTCATCGT CGGTCCGGGCTGCCACGACCAAGTGACAGCAATGCTGTTTCACTGGTTAT GCGGCGAATCCGAAAAGAAAACGTTGATGCCGGTGAACGTGCAAAACAGG CTCTAGCGTTCGAACGCACTGATTTCGACCAGGTTCGTTCACTCATGGAA AATAGCGATCGCTGCCAGGATATACGTAATCTGGCATTTCTGGGGATTGC TTATAACACCCTGTTACGTATAGCCGAAATTGCCAGGATCAGGGTTAAAG ATATCTCACGTACTGACGGTGGGAGAATGTTAATCCATATTGGCAGAACG AAAACGCTGGTTAGCACCGCAGGTGTAGAGAAGGCACTTAGCCTGGGGGT AACTAAACTGGTCGAGCGATGGATTTCCGTCTCTGGTGTAGCTGATGATC CGAATAACTACCTGTTTTGCCGGGTCAGAAAAAATGGTGTTGCCGCGCCA TCTGCCACCAGCCAGCTATCAACTCGCGCCCTGGAAGGGATTTTTGAAGC AACTCATCGATTGATTTACGGCGCTAAGGATGACTCTGGTCAGAGATACC TGGCCTGGTCTGGACACAGTGCCCGTGTCGGAGCCGCGCGAGATATGGCC CGCGCTGGAGTTTCAATACCGGAGATCATGCAAGCTGGTGGCTGGACCAA TGTAAATATTGTCATGAACTATATCCGTAACCTGGATAGTGAAACAGGGG CAATGGTGCGCCTGCTGGAAGATGGCGACtag