Milo:No background cloning protocol
Overview
This method eliminates the appearance of false-positive clones by direct selection for correctly assembled constructs. In this method we add an additional PCR step in which we concatenate a resistance marker to our desired insert. This resistance marker should be different from the resistance marker that is found on the vector in order to allow proper selection (we are using chloramphenicol resistance marker, but any other resistance marker should work as well). Just by adding one more PCR step the tedious process of screening either by colony PCR or by restriction validation is avoided. We (Milo lab) used this method to facilitate the serial assembly of multiple DNA sequences into a single construct[1].
Basic concept
The key feature of this method is the concatenation of a chloramphenicol resistance marker (CmR) : a constitutive promoter followed by a Chloramphenicol Acetyltransferase coding sequence, to each of the DNA sequences designated for assembly. The CmR cassette is paired to the DNA sequence using PCR overlap extension prior to the assembly process. When the target DNA sequence (now paired with the CmR) is assembled into a vector using a standard restriction-ligation process, only clones that were properly assembled are able to form colonies on agar plates supplemented with Cm. Since the resistance cassette is flanked by restriction sites (figure 1), it can be easily removed when preparing the vector for the next assembly cycle. In this manner, it is possible to perform multiple assembly rounds while using a single resistance marker.
Construction of chloramphenicol resistance cassette
The resistance cassette must contain a constitutive promoter with the resistance marker. We used chloramphenicol acetyltransferase gene and its promoter as the resistance marker (we used pSB3C5 plasmid as a template (BioPart: BBa_P1004)). We suggested adding a flanking restriction sites to the resistance cassette in order to regenerate the vector for additional step of cloning while using the same resistance marker. In our lab we flanked our resistance cassette with NheI site at the 5’ and NheI & XhoI sites in its 3'. Our chloramphenicol cassette sequence is:
1 gctagcgttg atcgggcacg taagaggttc caactttcac cataatgaaa taagatcact 61 accgggcgta ttttttgagt tatcgagatt ttcaggagct aaggaagcta aaatggagaa 121 aaaaatcacg ggatatacca ccgttgatat atcccaatgg catcgtaaag aacattttga 181 ggcatttcag tcagttgctc aatgtaccta taaccagacc gttcagctgg atattacggc 241 ctttttaaag accgtaaaga aaaataagca caagttttat ccggccttta ttcacattct 301 tgcccgcctg atgaacgctc acccggagtt tcgtatggcc atgaaagacg gtgagctggt 361 gatctgggat agtgttcacc cttgttacac cgttttccat gagcaaactg aaacgttttc 421 gtccctctgg agtgaatacc acgacgattt ccggcagttt ctccacatat attcgcaaga 481 tgtggcgtgt tacggtgaaa acctggccta tttccctaaa gggtttattg agaatatgtt 541 ttttgtctca gccaatccct gggtgagttt caccagtttt gatttaaacg tggccaatat 601 ggacaacttc ttcgcccccg ttttcacgat gggcaaatat tatacgcaag gcgacaaggt 661 gctgatgccg ctggcgatcc aggttcatca tgccgtttgt gatggcttcc atgtcggccg 721 catgcttaat gaattacaac agtactgtga tgagtggcag ggcggggcgt aataagctag 781 cgcggccgct cgagcgc
Making chloramphenicol cassette (cap cassette) stock PCR product
Amplify pSB3C5 (BioPart: BBa_P1004) plasmid using the following primers:
Cap F primer : 5`-GCTAGCGTTGATCGGGCACGTAAGAG-3` Cap R primer : 5`-GCGCTCGAGCGGCCGCGCTAGCTTATTACG-3`
We recommend to use phusion high fidelity polymerase, but any other polymerase should work as well. The hybridization temperature should be 60 (Celsius) degrees. Run the PCR product on agarose gel, cut the gel, extract it using standard DNA extraction Kit (we use Zymoclean™ Gel DNA Recovery Kit). Elute the PCR product in final volume of 50ul.This will serve as the stock template for the cap cassette.
Preparing the desired insert
Add the following sequence ( 5`- CTCTTACGTGCCCGATCAACGCTAGC -3` ) to the 5` end of the reverse primer of your gene of interest . Amplify your insert using a regular PCR protocol. Run and clean it from agarose gel.
Attaching gene of interest to the cap cassette
This procedure is based on PCR overhang extension technique [2] (SOE PCR). for a 50ul reaction add 0.5ul from your gene of interest PCR product and 0.5ul from the cap cassette PCR product. The primers should be : Gene of insert Forward primer and Cap R reverse primer (described above). We recommend trying first 60 degrees as hybridization temperature and then if failed perform Gradient PCR (from 45 to 70 in 5 degrees intervals) . The size of the desired PCR product should be as the size of the gene of interest with the addition of 800 b.p (resulting from the attachment of the cap cassette).
How to use the gene-cap PCR product
Once you get the gene-cap PCR product , you can either digest it with the relevant restriction sites and ligate it to the desired vector (don’t forget to add to the plate the additional antibiotic) , or you can directly ligate the PCR product to a blunt digested vector ( such as a KS bluescirpt ECORV digested) as sub-cloning stage in order to verify the correct sequence. We recommend adding the sub-cloning stage.
Concrete example for primers design
Suppose we would like to attach GFP to the cap cassette , we would need to amplify the GFP sequences while adding homology site (around 20-30 b.p depending the sequence) to the 3` of the PCR product. The best way to add homology site is by synthesized primer with the relevant homology. When designing primers the forward primer remains the same while we will add to the 5` of the reverse primer the following sequence 5`- CTCTTACGTGCCCGATCAACGCTAGC-3` (we found this sequence suitable for all of our overhang extension PCRs). We will amplify GFP by using standart PCR reaction with hybridization temperature of 60- 65 degrees. Example of the primers for GFP amplification:
GFP Forward 5`- ATGGTGAGCAAGGGCGAGGAG – 3`
GFP-CAR Reverse 5-` - CTCTTACGTGCCCGATCAACGCTAGCTTACTTGTACAGCTCGTCCATGC – 3`
- bold indicates the 26 b.p homology to the cap cassette which is necessary for successful overhang extension PCR
GFP sequence: 1 atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 61 ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 121 ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 181 ctcgtgacca ccctgaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag 241 cagcacgact tcttcaagtc caccatgccc gaaggctacg tccaggagcg caccatcttc 301 ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 361 gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 421 aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 481 ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc 541 gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 601 tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 661 ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaagtaa
Notes
The overhang extension protocol works well for PCR product up to 2,500bp (not including the cap cassette).We encountered some difficulties for some of the PCR products. We circumvented this problem by first sub-cloning this PCR product to Blue white screening vector and then adding the cap cassette using conventional restriction ligation procedure.
Please feel free to post comments, questions, or improvements to this protocol. Happy to have your input!
- List troubleshooting tips here.
- You can also link to FAQs/tips provided by other sources such as the manufacturer or other websites.
- Anecdotal observations that might be of use to others can also be posted here.
Please sign your name to your note by adding '''*~~~~''': to the beginning of your tip.
References
Relevant papers and books
- Zelcbuch et al, 2013 ( ) Nucleic acid research - PMID 23470993
- Matsumura (2013) - Bio Techniques PMID 23477381
Contact
or instead, discuss this protocol.