Milo:No background cloning protocol

From OpenWetWare
Jump to navigationJump to search

Overview

This method eliminates the appearance of false-positive clones by direct selection for correctly assembled constructs. In this method we add an additional PCR step in which we concatenate a resistance marker to our desired insert. This resistance marker should be different from the resistance marker that is found on the vector in order to allow proper selection (we are using chloramphenicol resistance marker, but any other resistance marker should work as well). Just by adding one more PCR step the tedious process of screening either by colony PCR or by restriction validation is avoided. We (Milo lab) used this method to facilitate the serial assembly of multiple DNA sequences into a single construct[1].

Basic concept

The key feature of this method is the concatenation of a chloramphenicol resistance marker (CmR) : a constitutive promoter followed by a Chloramphenicol Acetyltransferase coding sequence, to each of the DNA sequences designated for assembly. The CmR cassette is paired to the DNA sequence using PCR overlap extension prior to the assembly process. When the target DNA sequence (now paired with the CmR) is assembled into a vector using a standard restriction-ligation process, only clones that were properly assembled are able to form colonies on agar plates supplemented with Cm. Since the resistance cassette is flanked by restriction sites (figure 1), it can be easily removed when preparing the vector for the next assembly cycle. In this manner, it is possible to perform multiple assembly rounds while using a single resistance marker.

Construction of chloramphenicol resistance cassette

The resistance cassette must contain a constitutive promoter with the resistance marker. We used chloramphenicol acetyltransferase gene and its promoter as the resistance marker (we used pSB3C5 plasmid as a template (BioPart: BBa_P1004)). We suggested adding a flanking restriction sites to the resistance cassette in order to regenerate the vector for additional step of cloning while using the same resistance marker. In our lab we flanked our resistance cassette with NheI site at the 5’ and NheI & XhoI sites in its 3'. Our chloramphenicol cassette sequence is:


 1  gctagcgttg atcgggcacg taagaggttc caactttcac cataatgaaa taagatcact  
61  accgggcgta ttttttgagt tatcgagatt ttcaggagct aaggaagcta aaatggagaa  
121  aaaaatcacg ggatatacca ccgttgatat atcccaatgg catcgtaaag aacattttga  
181  ggcatttcag tcagttgctc aatgtaccta taaccagacc gttcagctgg atattacggc  
241  ctttttaaag accgtaaaga aaaataagca caagttttat ccggccttta ttcacattct  
301  tgcccgcctg atgaacgctc acccggagtt tcgtatggcc atgaaagacg gtgagctggt  
361  gatctgggat agtgttcacc cttgttacac cgttttccat gagcaaactg aaacgttttc  
421  gtccctctgg agtgaatacc acgacgattt ccggcagttt ctccacatat attcgcaaga  
481  tgtggcgtgt tacggtgaaa acctggccta tttccctaaa gggtttattg agaatatgtt  
541  ttttgtctca gccaatccct gggtgagttt caccagtttt gatttaaacg tggccaatat  
601  ggacaacttc ttcgcccccg ttttcacgat gggcaaatat tatacgcaag gcgacaaggt  
661  gctgatgccg ctggcgatcc aggttcatca tgccgtttgt gatggcttcc atgtcggccg  
721  catgcttaat gaattacaac agtactgtga tgagtggcag ggcggggcgt aataagctag  
781  cgcggccgct cgagcgc


Making chloramphenicol cassette (cap cassette) stock PCR product

Amplify pSB3C5 (BioPart: BBa_P1004) plasmid using the following primers:

Cap F primer : 5`-GCTAGCGTTGATCGGGCACGTAAGAG-3`
Cap R primer : 5`-GCGCTCGAGCGGCCGCGCTAGCTTATTACG-3`

We recommend to use phusion high fidelity polymerase, but any other polymerase should work as well. The hybridization temperature should be 60 (Celsius) degrees. Run the PCR product on agarose gel, cut the gel, extract it using standard DNA extraction Kit (we use Zymoclean™ Gel DNA Recovery Kit). Elute the PCR product in final volume of 50ul.This will serve as the stock template for the cap cassette.

Preparing the desired insert

Add the following sequence ( 5`- CTCTTACGTGCCCGATCAACGCTAGC -3` ) to the 5` end of the reverse primer of your gene of interest . Amplify your insert using a regular PCR protocol. Run and clean it from agarose gel.

Attaching gene of interest to the cap cassette

This procedure is based on PCR overhang extension technique [2] (SOE PCR). for a 50ul reaction add 0.5ul from your gene of interest PCR product and 0.5ul from the cap cassette PCR product. The primers should be : Gene of insert Forward primer and Cap R reverse primer (described above). We recommend trying first 60 degrees as hybridization temperature and then if failed perform Gradient PCR (from 45 to 70 in 5 degrees intervals) . The size of the desired PCR product should be as the size of the gene of interest with the addition of 800 b.p (resulting from the attachment of the cap cassette).

How to use the gene-cap PCR product

Once you get the gene-cap PCR product , you can either digest it with the relevant restriction sites and ligate it to the desired vector (don’t forget to add to the plate the additional antibiotic) , or you can directly ligate the PCR product to a blunt digested vector ( such as a KS bluescirpt ECORV digested) as sub-cloning stage in order to verify the correct sequence. We recommend adding the sub-cloning stage.

Concrete example for primers design

Suppose we would like to attach GFP to the cap cassette , we would need to amplify the GFP sequences while adding homology site (around 20-30 b.p depending the sequence) to the 3` of the PCR product. The best way to add homology site is by synthesized primer with the relevant homology. When designing primers the forward primer remains the same while we will add to the 5` of the reverse primer the following sequence 5`- CTCTTACGTGCCCGATCAACGCTAGC-3` (we found this sequence suitable for all of our overhang extension PCRs). We will amplify GFP by using standart PCR reaction with hybridization temperature of 60- 65 degrees. Example of the primers for GFP amplification:

GFP Forward 5`- ATGGTGAGCAAGGGCGAGGAG – 3`

GFP-CAR Reverse 5-` - CTCTTACGTGCCCGATCAACGCTAGCTTACTTGTACAGCTCGTCCATGC – 3`

  • bold indicates the 26 b.p homology to the cap cassette which is necessary for successful overhang extension PCR
GFP sequence:
  1  atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac  
 61  ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac  
121  ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc  
181  ctcgtgacca ccctgaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag  
241  cagcacgact tcttcaagtc caccatgccc gaaggctacg tccaggagcg caccatcttc  
301  ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg  
361  gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac  
421  aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac  
481  ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc  
541  gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac  
601  tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc  
661  ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaagtaa  


Notes

The overhang extension protocol works well for PCR product up to 2,500bp (not including the cap cassette).We encountered some difficulties for some of the PCR products. We circumvented this problem by first sub-cloning this PCR product to Blue white screening vector and then adding the cap cassette using conventional restriction ligation procedure.

Please feel free to post comments, questions, or improvements to this protocol. Happy to have your input!

  1. List troubleshooting tips here.
  2. You can also link to FAQs/tips provided by other sources such as the manufacturer or other websites.
  3. Anecdotal observations that might be of use to others can also be posted here.

Please sign your name to your note by adding '''*~~~~''': to the beginning of your tip.

References

Relevant papers and books

  1. Zelcbuch et al, 2013 ( ) Nucleic acid research - PMID 23470993
  2. Matsumura (2013) - Bio Techniques PMID 23477381

Contact

[email protected]

or instead, discuss this protocol.