Mid-February 2010:

From OpenWetWare
Jump to: navigation, search

<html xmlns:v="urn:schemas-microsoft-com:vml" xmlns:o="urn:schemas-microsoft-com:office:office" xmlns:w="urn:schemas-microsoft-com:office:word" xmlns:m="http://schemas.microsoft.com/office/2004/12/omml" xmlns="http://www.w3.org/TR/REC-html40">

<head> <meta http-equiv=Content-Type content="text/html; charset=windows-1252"> <meta name=ProgId content=Word.Document> <meta name=Generator content="Microsoft Word 12"> <meta name=Originator content="Microsoft Word 12"> <link rel=File-List href="GenoCAD%20workflow%20and%20tutorial_files/filelist.xml"> <link rel=Edit-Time-Data href="GenoCAD%20workflow%20and%20tutorial_files/editdata.mso"> <!--[if !mso]> <style> v\:* {behavior:url(#default#VML);} o\:* {behavior:url(#default#VML);} w\:* {behavior:url(#default#VML);} .shape {behavior:url(#default#VML);} </style> <![endif]--><!--[if gte mso 9]><xml>

<o:DocumentProperties>
 <o:Author>Andre Forbes</o:Author>
 <o:Template>Normal</o:Template>
 <o:LastAuthor>Andre Forbes</o:LastAuthor>
 <o:Revision>6</o:Revision>
 <o:TotalTime>737</o:TotalTime>
 <o:Created>2010-11-05T18:36:00Z</o:Created>
 <o:LastSaved>2010-11-05T18:42:00Z</o:LastSaved>
 <o:Pages>2</o:Pages>
 <o:Words>7</o:Words>
 <o:Characters>9334</o:Characters>
 <o:Lines>115</o:Lines>
 <o:Paragraphs>7</o:Paragraphs>
 <o:CharactersWithSpaces>9334</o:CharactersWithSpaces>
 <o:Version>12.00</o:Version>
</o:DocumentProperties>
<o:OfficeDocumentSettings>
 <o:RelyOnVML/>
 <o:AllowPNG/>
</o:OfficeDocumentSettings>

</xml><![endif]--> <link rel=themeData href="GenoCAD%20workflow%20and%20tutorial_files/themedata.thmx"> <link rel=colorSchemeMapping href="GenoCAD%20workflow%20and%20tutorial_files/colorschememapping.xml"> <!--[if gte mso 9]><xml>

<w:WordDocument>
 <w:Zoom>80</w:Zoom>
 <w:TrackMoves>false</w:TrackMoves>
 <w:TrackFormatting/>
 <w:PunctuationKerning/>
 <w:ValidateAgainstSchemas/>
 <w:SaveIfXMLInvalid>false</w:SaveIfXMLInvalid>
 <w:IgnoreMixedContent>false</w:IgnoreMixedContent>
 <w:AlwaysShowPlaceholderText>false</w:AlwaysShowPlaceholderText>
 <w:DoNotPromoteQF/>
 <w:LidThemeOther>EN-US</w:LidThemeOther>
 <w:LidThemeAsian>X-NONE</w:LidThemeAsian>
 <w:LidThemeComplexScript>X-NONE</w:LidThemeComplexScript>
 <w:Compatibility>
  <w:BreakWrappedTables/>
  <w:SnapToGridInCell/>
  <w:WrapTextWithPunct/>
  <w:UseAsianBreakRules/>
  <w:DontGrowAutofit/>
  <w:SplitPgBreakAndParaMark/>
  <w:DontVertAlignCellWithSp/>
  <w:DontBreakConstrainedForcedTables/>
  <w:DontVertAlignInTxbx/>
  <w:Word11KerningPairs/>
  <w:CachedColBalance/>
 </w:Compatibility>
 <w:BrowserLevel>MicrosoftInternetExplorer4</w:BrowserLevel>
 <m:mathPr>
  <m:mathFont m:val="Cambria Math"/>
  <m:brkBin m:val="before"/>
  <m:brkBinSub m:val="&#45;-"/>
  <m:smallFrac m:val="off"/>
  <m:dispDef/>
  <m:lMargin m:val="0"/>
  <m:rMargin m:val="0"/>
  <m:defJc m:val="centerGroup"/>
  <m:wrapIndent m:val="1440"/>
  <m:intLim m:val="subSup"/>
  <m:naryLim m:val="undOvr"/>
 </m:mathPr></w:WordDocument>

</xml><![endif]--><!--[if gte mso 9]><xml>

<w:LatentStyles DefLockedState="false" DefUnhideWhenUsed="true"
 DefSemiHidden="true" DefQFormat="false" DefPriority="99"
 LatentStyleCount="267">
 <w:LsdException Locked="false" Priority="0" SemiHidden="false"
  UnhideWhenUsed="false" QFormat="true" Name="Normal"/>
 <w:LsdException Locked="false" Priority="9" SemiHidden="false"
  UnhideWhenUsed="false" QFormat="true" Name="heading 1"/>
 <w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 2"/>
 <w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 3"/>
 <w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 4"/>
 <w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 5"/>
 <w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 6"/>
 <w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 7"/>
 <w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 8"/>
 <w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 9"/>
 <w:LsdException Locked="false" Priority="39" Name="toc 1"/>
 <w:LsdException Locked="false" Priority="39" Name="toc 2"/>
 <w:LsdException Locked="false" Priority="39" Name="toc 3"/>
 <w:LsdException Locked="false" Priority="39" Name="toc 4"/>
 <w:LsdException Locked="false" Priority="39" Name="toc 5"/>
 <w:LsdException Locked="false" Priority="39" Name="toc 6"/>
 <w:LsdException Locked="false" Priority="39" Name="toc 7"/>
 <w:LsdException Locked="false" Priority="39" Name="toc 8"/>
 <w:LsdException Locked="false" Priority="39" Name="toc 9"/>
 <w:LsdException Locked="false" Priority="35" QFormat="true" Name="caption"/>
 <w:LsdException Locked="false" Priority="10" SemiHidden="false"
  UnhideWhenUsed="false" QFormat="true" Name="Title"/>
 <w:LsdException Locked="false" Priority="1" Name="Default Paragraph Font"/>
 <w:LsdException Locked="false" Priority="11" SemiHidden="false"
  UnhideWhenUsed="false" QFormat="true" Name="Subtitle"/>
 <w:LsdException Locked="false" Priority="22" SemiHidden="false"
  UnhideWhenUsed="false" QFormat="true" Name="Strong"/>
 <w:LsdException Locked="false" Priority="20" SemiHidden="false"
  UnhideWhenUsed="false" QFormat="true" Name="Emphasis"/>
 <w:LsdException Locked="false" Priority="59" SemiHidden="false"
  UnhideWhenUsed="false" Name="Table Grid"/>
 <w:LsdException Locked="false" UnhideWhenUsed="false" Name="Placeholder Text"/>
 <w:LsdException Locked="false" Priority="1" SemiHidden="false"
  UnhideWhenUsed="false" QFormat="true" Name="No Spacing"/>
 <w:LsdException Locked="false" Priority="60" SemiHidden="false"
  UnhideWhenUsed="false" Name="Light Shading"/>
 <w:LsdException Locked="false" Priority="61" SemiHidden="false"
  UnhideWhenUsed="false" Name="Light List"/>
 <w:LsdException Locked="false" Priority="62" SemiHidden="false"
  UnhideWhenUsed="false" Name="Light Grid"/>
 <w:LsdException Locked="false" Priority="63" SemiHidden="false"
  UnhideWhenUsed="false" Name="Medium Shading 1"/>
 <w:LsdException Locked="false" Priority="64" SemiHidden="false"
  UnhideWhenUsed="false" Name="Medium Shading 2"/>
 <w:LsdException Locked="false" Priority="65" SemiHidden="false"
  UnhideWhenUsed="false" Name="Medium List 1"/>
 <w:LsdException Locked="false" Priority="66" SemiHidden="false"
  UnhideWhenUsed="false" Name="Medium List 2"/>
 <w:LsdException Locked="false" Priority="67" SemiHidden="false"
  UnhideWhenUsed="false" Name="Medium Grid 1"/>
 <w:LsdException Locked="false" Priority="68" SemiHidden="false"
  UnhideWhenUsed="false" Name="Medium Grid 2"/>
 <w:LsdException Locked="false" Priority="69" SemiHidden="false"
  UnhideWhenUsed="false" Name="Medium Grid 3"/>
 <w:LsdException Locked="false" Priority="70" SemiHidden="false"
  UnhideWhenUsed="false" Name="Dark List"/>
 <w:LsdException Locked="false" Priority="71" SemiHidden="false"
  UnhideWhenUsed="false" Name="Colorful Shading"/>
 <w:LsdException Locked="false" Priority="72" SemiHidden="false"
  UnhideWhenUsed="false" Name="Colorful List"/>
 <w:LsdException Locked="false" Priority="73" SemiHidden="false"
  UnhideWhenUsed="false" Name="Colorful Grid"/>
 <w:LsdException Locked="false" Priority="60" SemiHidden="false"
  UnhideWhenUsed="false" Name="Light Shading Accent 1"/>
 <w:LsdException Locked="false" Priority="61" SemiHidden="false"
  UnhideWhenUsed="false" Name="Light List Accent 1"/>
 <w:LsdException Locked="false" Priority="62" SemiHidden="false"
  UnhideWhenUsed="false" Name="Light Grid Accent 1"/>
 <w:LsdException Locked="false" Priority="63" SemiHidden="false"
  UnhideWhenUsed="false" Name="Medium Shading 1 Accent 1"/>
 <w:LsdException Locked="false" Priority="64" SemiHidden="false"
  UnhideWhenUsed="false" Name="Medium Shading 2 Accent 1"/>
 <w:LsdException Locked="false" Priority="65" SemiHidden="false"
  UnhideWhenUsed="false" Name="Medium List 1 Accent 1"/>
 <w:LsdException Locked="false" UnhideWhenUsed="false" Name="Revision"/>
 <w:LsdException Locked="false" Priority="34" SemiHidden="false"
  UnhideWhenUsed="false" QFormat="true" Name="List Paragraph"/>
 <w:LsdException Locked="false" Priority="29" SemiHidden="false"
  UnhideWhenUsed="false" QFormat="true" Name="Quote"/>
 <w:LsdException Locked="false" Priority="30" SemiHidden="false"
  UnhideWhenUsed="false" QFormat="true" Name="Intense Quote"/>
 <w:LsdException Locked="false" Priority="66" SemiHidden="false"
  UnhideWhenUsed="false" Name="Medium List 2 Accent 1"/>
 <w:LsdException Locked="false" Priority="67" SemiHidden="false"
  UnhideWhenUsed="false" Name="Medium Grid 1 Accent 1"/>
 <w:LsdException Locked="false" Priority="68" SemiHidden="false"
  UnhideWhenUsed="false" Name="Medium Grid 2 Accent 1"/>
 <w:LsdException Locked="false" Priority="69" SemiHidden="false"
  UnhideWhenUsed="false" Name="Medium Grid 3 Accent 1"/>
 <w:LsdException Locked="false" Priority="70" SemiHidden="false"
  UnhideWhenUsed="false" Name="Dark List Accent 1"/>
 <w:LsdException Locked="false" Priority="71" SemiHidden="false"
  UnhideWhenUsed="false" Name="Colorful Shading Accent 1"/>
 <w:LsdException Locked="false" Priority="72" SemiHidden="false"
  UnhideWhenUsed="false" Name="Colorful List Accent 1"/>
 <w:LsdException Locked="false" Priority="73" SemiHidden="false"
  UnhideWhenUsed="false" Name="Colorful Grid Accent 1"/>
 <w:LsdException Locked="false" Priority="60" SemiHidden="false"
  UnhideWhenUsed="false" Name="Light Shading Accent 2"/>
 <w:LsdException Locked="false" Priority="61" SemiHidden="false"
  UnhideWhenUsed="false" Name="Light List Accent 2"/>
 <w:LsdException Locked="false" Priority="62" SemiHidden="false"
  UnhideWhenUsed="false" Name="Light Grid Accent 2"/>
 <w:LsdException Locked="false" Priority="63" SemiHidden="false"
  UnhideWhenUsed="false" Name="Medium Shading 1 Accent 2"/>
 <w:LsdException Locked="false" Priority="64" SemiHidden="false"
  UnhideWhenUsed="false" Name="Medium Shading 2 Accent 2"/>
 <w:LsdException Locked="false" Priority="65" SemiHidden="false"
  UnhideWhenUsed="false" Name="Medium List 1 Accent 2"/>
 <w:LsdException Locked="false" Priority="66" SemiHidden="false"
  UnhideWhenUsed="false" Name="Medium List 2 Accent 2"/>
 <w:LsdException Locked="false" Priority="67" SemiHidden="false"
  UnhideWhenUsed="false" Name="Medium Grid 1 Accent 2"/>
 <w:LsdException Locked="false" Priority="68" SemiHidden="false"
  UnhideWhenUsed="false" Name="Medium Grid 2 Accent 2"/>
 <w:LsdException Locked="false" Priority="69" SemiHidden="false"
  UnhideWhenUsed="false" Name="Medium Grid 3 Accent 2"/>
 <w:LsdException Locked="false" Priority="70" SemiHidden="false"
  UnhideWhenUsed="false" Name="Dark List Accent 2"/>
 <w:LsdException Locked="false" Priority="71" SemiHidden="false"
  UnhideWhenUsed="false" Name="Colorful Shading Accent 2"/>
 <w:LsdException Locked="false" Priority="72" SemiHidden="false"
  UnhideWhenUsed="false" Name="Colorful List Accent 2"/>
 <w:LsdException Locked="false" Priority="73" SemiHidden="false"
  UnhideWhenUsed="false" Name="Colorful Grid Accent 2"/>
 <w:LsdException Locked="false" Priority="60" SemiHidden="false"
  UnhideWhenUsed="false" Name="Light Shading Accent 3"/>
 <w:LsdException Locked="false" Priority="61" SemiHidden="false"
  UnhideWhenUsed="false" Name="Light List Accent 3"/>
 <w:LsdException Locked="false" Priority="62" SemiHidden="false"
  UnhideWhenUsed="false" Name="Light Grid Accent 3"/>
 <w:LsdException Locked="false" Priority="63" SemiHidden="false"
  UnhideWhenUsed="false" Name="Medium Shading 1 Accent 3"/>
 <w:LsdException Locked="false" Priority="64" SemiHidden="false"
  UnhideWhenUsed="false" Name="Medium Shading 2 Accent 3"/>
 <w:LsdException Locked="false" Priority="65" SemiHidden="false"
  UnhideWhenUsed="false" Name="Medium List 1 Accent 3"/>
 <w:LsdException Locked="false" Priority="66" SemiHidden="false"
  UnhideWhenUsed="false" Name="Medium List 2 Accent 3"/>
 <w:LsdException Locked="false" Priority="67" SemiHidden="false"
  UnhideWhenUsed="false" Name="Medium Grid 1 Accent 3"/>
 <w:LsdException Locked="false" Priority="68" SemiHidden="false"
  UnhideWhenUsed="false" Name="Medium Grid 2 Accent 3"/>
 <w:LsdException Locked="false" Priority="69" SemiHidden="false"
  UnhideWhenUsed="false" Name="Medium Grid 3 Accent 3"/>
 <w:LsdException Locked="false" Priority="70" SemiHidden="false"
  UnhideWhenUsed="false" Name="Dark List Accent 3"/>
 <w:LsdException Locked="false" Priority="71" SemiHidden="false"
  UnhideWhenUsed="false" Name="Colorful Shading Accent 3"/>
 <w:LsdException Locked="false" Priority="72" SemiHidden="false"
  UnhideWhenUsed="false" Name="Colorful List Accent 3"/>
 <w:LsdException Locked="false" Priority="73" SemiHidden="false"
  UnhideWhenUsed="false" Name="Colorful Grid Accent 3"/>
 <w:LsdException Locked="false" Priority="60" SemiHidden="false"
  UnhideWhenUsed="false" Name="Light Shading Accent 4"/>
 <w:LsdException Locked="false" Priority="61" SemiHidden="false"
  UnhideWhenUsed="false" Name="Light List Accent 4"/>
 <w:LsdException Locked="false" Priority="62" SemiHidden="false"
  UnhideWhenUsed="false" Name="Light Grid Accent 4"/>
 <w:LsdException Locked="false" Priority="63" SemiHidden="false"
  UnhideWhenUsed="false" Name="Medium Shading 1 Accent 4"/>
 <w:LsdException Locked="false" Priority="64" SemiHidden="false"
  UnhideWhenUsed="false" Name="Medium Shading 2 Accent 4"/>
 <w:LsdException Locked="false" Priority="65" SemiHidden="false"
  UnhideWhenUsed="false" Name="Medium List 1 Accent 4"/>
 <w:LsdException Locked="false" Priority="66" SemiHidden="false"
  UnhideWhenUsed="false" Name="Medium List 2 Accent 4"/>
 <w:LsdException Locked="false" Priority="67" SemiHidden="false"
  UnhideWhenUsed="false" Name="Medium Grid 1 Accent 4"/>
 <w:LsdException Locked="false" Priority="68" SemiHidden="false"
  UnhideWhenUsed="false" Name="Medium Grid 2 Accent 4"/>
 <w:LsdException Locked="false" Priority="69" SemiHidden="false"
  UnhideWhenUsed="false" Name="Medium Grid 3 Accent 4"/>
 <w:LsdException Locked="false" Priority="70" SemiHidden="false"
  UnhideWhenUsed="false" Name="Dark List Accent 4"/>
 <w:LsdException Locked="false" Priority="71" SemiHidden="false"
  UnhideWhenUsed="false" Name="Colorful Shading Accent 4"/>
 <w:LsdException Locked="false" Priority="72" SemiHidden="false"
  UnhideWhenUsed="false" Name="Colorful List Accent 4"/>
 <w:LsdException Locked="false" Priority="73" SemiHidden="false"
  UnhideWhenUsed="false" Name="Colorful Grid Accent 4"/>
 <w:LsdException Locked="false" Priority="60" SemiHidden="false"
  UnhideWhenUsed="false" Name="Light Shading Accent 5"/>
 <w:LsdException Locked="false" Priority="61" SemiHidden="false"
  UnhideWhenUsed="false" Name="Light List Accent 5"/>
 <w:LsdException Locked="false" Priority="62" SemiHidden="false"
  UnhideWhenUsed="false" Name="Light Grid Accent 5"/>
 <w:LsdException Locked="false" Priority="63" SemiHidden="false"
  UnhideWhenUsed="false" Name="Medium Shading 1 Accent 5"/>
 <w:LsdException Locked="false" Priority="64" SemiHidden="false"
  UnhideWhenUsed="false" Name="Medium Shading 2 Accent 5"/>
 <w:LsdException Locked="false" Priority="65" SemiHidden="false"
  UnhideWhenUsed="false" Name="Medium List 1 Accent 5"/>
 <w:LsdException Locked="false" Priority="66" SemiHidden="false"
  UnhideWhenUsed="false" Name="Medium List 2 Accent 5"/>
 <w:LsdException Locked="false" Priority="67" SemiHidden="false"
  UnhideWhenUsed="false" Name="Medium Grid 1 Accent 5"/>
 <w:LsdException Locked="false" Priority="68" SemiHidden="false"
  UnhideWhenUsed="false" Name="Medium Grid 2 Accent 5"/>
 <w:LsdException Locked="false" Priority="69" SemiHidden="false"
  UnhideWhenUsed="false" Name="Medium Grid 3 Accent 5"/>
 <w:LsdException Locked="false" Priority="70" SemiHidden="false"
  UnhideWhenUsed="false" Name="Dark List Accent 5"/>
 <w:LsdException Locked="false" Priority="71" SemiHidden="false"
  UnhideWhenUsed="false" Name="Colorful Shading Accent 5"/>
 <w:LsdException Locked="false" Priority="72" SemiHidden="false"
  UnhideWhenUsed="false" Name="Colorful List Accent 5"/>
 <w:LsdException Locked="false" Priority="73" SemiHidden="false"
  UnhideWhenUsed="false" Name="Colorful Grid Accent 5"/>
 <w:LsdException Locked="false" Priority="60" SemiHidden="false"
  UnhideWhenUsed="false" Name="Light Shading Accent 6"/>
 <w:LsdException Locked="false" Priority="61" SemiHidden="false"
  UnhideWhenUsed="false" Name="Light List Accent 6"/>
 <w:LsdException Locked="false" Priority="62" SemiHidden="false"
  UnhideWhenUsed="false" Name="Light Grid Accent 6"/>
 <w:LsdException Locked="false" Priority="63" SemiHidden="false"
  UnhideWhenUsed="false" Name="Medium Shading 1 Accent 6"/>
 <w:LsdException Locked="false" Priority="64" SemiHidden="false"
  UnhideWhenUsed="false" Name="Medium Shading 2 Accent 6"/>
 <w:LsdException Locked="false" Priority="65" SemiHidden="false"
  UnhideWhenUsed="false" Name="Medium List 1 Accent 6"/>
 <w:LsdException Locked="false" Priority="66" SemiHidden="false"
  UnhideWhenUsed="false" Name="Medium List 2 Accent 6"/>
 <w:LsdException Locked="false" Priority="67" SemiHidden="false"
  UnhideWhenUsed="false" Name="Medium Grid 1 Accent 6"/>
 <w:LsdException Locked="false" Priority="68" SemiHidden="false"
  UnhideWhenUsed="false" Name="Medium Grid 2 Accent 6"/>
 <w:LsdException Locked="false" Priority="69" SemiHidden="false"
  UnhideWhenUsed="false" Name="Medium Grid 3 Accent 6"/>
 <w:LsdException Locked="false" Priority="70" SemiHidden="false"
  UnhideWhenUsed="false" Name="Dark List Accent 6"/>
 <w:LsdException Locked="false" Priority="71" SemiHidden="false"
  UnhideWhenUsed="false" Name="Colorful Shading Accent 6"/>
 <w:LsdException Locked="false" Priority="72" SemiHidden="false"
  UnhideWhenUsed="false" Name="Colorful List Accent 6"/>
 <w:LsdException Locked="false" Priority="73" SemiHidden="false"
  UnhideWhenUsed="false" Name="Colorful Grid Accent 6"/>
 <w:LsdException Locked="false" Priority="19" SemiHidden="false"
  UnhideWhenUsed="false" QFormat="true" Name="Subtle Emphasis"/>
 <w:LsdException Locked="false" Priority="21" SemiHidden="false"
  UnhideWhenUsed="false" QFormat="true" Name="Intense Emphasis"/>
 <w:LsdException Locked="false" Priority="31" SemiHidden="false"
  UnhideWhenUsed="false" QFormat="true" Name="Subtle Reference"/>
 <w:LsdException Locked="false" Priority="32" SemiHidden="false"
  UnhideWhenUsed="false" QFormat="true" Name="Intense Reference"/>
 <w:LsdException Locked="false" Priority="33" SemiHidden="false"
  UnhideWhenUsed="false" QFormat="true" Name="Book Title"/>
 <w:LsdException Locked="false" Priority="37" Name="Bibliography"/>
 <w:LsdException Locked="false" Priority="39" QFormat="true" Name="TOC Heading"/>
</w:LatentStyles>

</xml><![endif]--> <style> <!--

/* Font Definitions */
@font-face

{font-family:"Cambria Math"; panose-1:2 4 5 3 5 4 6 3 2 4; mso-font-charset:0; mso-generic-font-family:roman; mso-font-pitch:variable; mso-font-signature:-1610611985 1107304683 0 0 415 0;} @font-face {font-family:Cambria; panose-1:2 4 5 3 5 4 6 3 2 4; mso-font-charset:0; mso-generic-font-family:roman; mso-font-pitch:variable; mso-font-signature:-1610611985 1073741899 0 0 415 0;} @font-face {font-family:Calibri; panose-1:2 15 5 2 2 2 4 3 2 4; mso-font-charset:0; mso-generic-font-family:swiss; mso-font-pitch:variable; mso-font-signature:-520092929 1073786111 9 0 415 0;} @font-face {font-family:Tahoma; panose-1:2 11 6 4 3 5 4 4 2 4; mso-font-charset:0; mso-generic-font-family:swiss; mso-font-pitch:variable; mso-font-signature:-520081665 -1073717157 41 0 66047 0;}

/* Style Definitions */
p.MsoNormal, li.MsoNormal, div.MsoNormal

{mso-style-unhide:no; mso-style-qformat:yes; mso-style-parent:""; margin-top:0in; margin-right:0in; margin-bottom:10.0pt; margin-left:0in; line-height:115%; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:Calibri; mso-fareast-theme-font:minor-latin; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} h1 {mso-style-priority:9; mso-style-unhide:no; mso-style-qformat:yes; mso-style-link:"Heading 1 Char"; mso-style-next:Normal; margin-top:24.0pt; margin-right:0in; margin-bottom:0in; margin-left:0in; margin-bottom:.0001pt; line-height:115%; mso-pagination:widow-orphan lines-together; page-break-after:avoid; mso-outline-level:1; font-size:14.0pt; font-family:"Cambria","serif"; mso-ascii-font-family:Cambria; mso-ascii-theme-font:major-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:major-fareast; mso-hansi-font-family:Cambria; mso-hansi-theme-font:major-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:major-bidi; color:#365F91; mso-themecolor:accent1; mso-themeshade:191; mso-font-kerning:0pt;} a:link, span.MsoHyperlink {mso-style-noshow:yes; mso-style-priority:99; color:blue; text-decoration:underline; text-underline:single;} a:visited, span.MsoHyperlinkFollowed {mso-style-noshow:yes; mso-style-priority:99; color:purple; mso-themecolor:followedhyperlink; text-decoration:underline; text-underline:single;} p.MsoAcetate, li.MsoAcetate, div.MsoAcetate {mso-style-noshow:yes; mso-style-priority:99; mso-style-link:"Balloon Text Char"; margin:0in; margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:8.0pt; font-family:"Tahoma","sans-serif"; mso-fareast-font-family:Calibri; mso-fareast-theme-font:minor-latin;} span.Heading1Char {mso-style-name:"Heading 1 Char"; mso-style-priority:9; mso-style-unhide:no; mso-style-locked:yes; mso-style-link:"Heading 1"; mso-ansi-font-size:14.0pt; mso-bidi-font-size:14.0pt; font-family:"Cambria","serif"; mso-ascii-font-family:Cambria; mso-ascii-theme-font:major-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:major-fareast; mso-hansi-font-family:Cambria; mso-hansi-theme-font:major-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:major-bidi; color:#365F91; mso-themecolor:accent1; mso-themeshade:191; font-weight:bold;} span.BalloonTextChar {mso-style-name:"Balloon Text Char"; mso-style-noshow:yes; mso-style-priority:99; mso-style-unhide:no; mso-style-locked:yes; mso-style-link:"Balloon Text"; mso-ansi-font-size:8.0pt; mso-bidi-font-size:8.0pt; font-family:"Tahoma","sans-serif"; mso-ascii-font-family:Tahoma; mso-hansi-font-family:Tahoma; mso-bidi-font-family:Tahoma;} .MsoChpDefault {mso-style-type:export-only; mso-default-props:yes; font-size:10.0pt; mso-ansi-font-size:10.0pt; mso-bidi-font-size:10.0pt; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:Calibri; mso-fareast-theme-font:minor-latin; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} @page Section1 {size:8.5in 11.0in; margin:1.0in 1.0in 1.0in 1.0in; mso-header-margin:.5in; mso-footer-margin:.5in; mso-paper-source:0;} div.Section1 {page:Section1;} --> </style> <!--[if gte mso 10]> <style>

/* Style Definitions */
table.MsoNormalTable

{mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin:0in; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:10.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} </style> <![endif]--><!--[if gte mso 9]><xml>

<o:shapedefaults v:ext="edit" spidmax="7170"/>

</xml><![endif]--><!--[if gte mso 9]><xml>

<o:shapelayout v:ext="edit">
 <o:idmap v:ext="edit" data="1"/>
</o:shapelayout></xml><![endif]-->

</head>

<body lang=EN-US link=blue vlink=purple style='tab-interval:.5in'>

<div class=Section1>

<h1><u>GenoCAD workflow and tutorial</u></h1>

<p class=MsoNormal><o:p>&nbsp;</o:p></p>

<p class=MsoNormal>Using the information gathered from analysis of the team wikis and provided design overviews; I attempted to recreate the designs using GenoCAD.</p>

<p class=MsoNormal><o:p>&nbsp;</o:p></p>

<p class=MsoNormal>First priority was the creation of a comprehensive, exhaustive list of the parts that would be required for each system. Each entry contains the parts name, Biobrick part #, the part type, pertinent data for regulatory parts and links to sequence data and other supplementary data.</p>

<p class=MsoNormal><o:p>&nbsp;</o:p></p>

<table class=MsoNormalTable border=0 cellspacing=0 cellpadding=0

style='border-collapse:collapse;mso-table-layout-alt:fixed;mso-yfti-tbllook:
1184;mso-padding-alt:0in 5.4pt 0in 5.4pt'>
<tr style='mso-yfti-irow:0;mso-yfti-firstrow:yes;height:31.15pt'>
 <td width=137 nowrap valign=bottom style='width:102.45pt;border-top:1.5pt;
 border-left:1.5pt;border-bottom:1.0pt;border-right:1.0pt;border-color:windowtext;
 border-style:solid;mso-border-top-alt:1.5pt;mso-border-left-alt:1.5pt;
 mso-border-bottom-alt:.5pt;mso-border-right-alt:.5pt;mso-border-color-alt:
 windowtext;mso-border-style-alt:solid;padding:0in 5.4pt 0in 5.4pt;height:
 31.15pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><b><u><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;
 mso-ascii-font-family:Calibri;mso-fareast-font-family:"Times New Roman";
 mso-hansi-font-family:Calibri;mso-bidi-font-family:Calibri;color:black'>University
 Groningen<o:p></o:p></span></u></b></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:solid windowtext 1.5pt;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-top-alt:solid windowtext 1.5pt;mso-border-bottom-alt:solid windowtext .5pt;
 mso-border-right-alt:solid windowtext .5pt;padding:0in 5.4pt 0in 5.4pt;
 height:31.15pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><b><u><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;
 mso-ascii-font-family:Calibri;mso-fareast-font-family:"Times New Roman";
 mso-hansi-font-family:Calibri;mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></u></b></p>
 </td>
 <td width=209 nowrap valign=bottom style='width:156.7pt;border-top:solid windowtext 1.5pt;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-top-alt:solid windowtext 1.5pt;mso-border-bottom-alt:solid windowtext .5pt;
 mso-border-right-alt:solid windowtext .5pt;padding:0in 5.4pt 0in 5.4pt;
 height:31.15pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:11.0pt'><a
 href="http://2008.igem.org/Team:Groningen"><span style='mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri'>http://2008.igem.org/Team:Groningen</span></a></span><u><span
 style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:Calibri;
 mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:blue'><o:p></o:p></span></u></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:solid windowtext 1.5pt;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-top-alt:solid windowtext 1.5pt;mso-border-bottom-alt:solid windowtext .5pt;
 mso-border-right-alt:solid windowtext .5pt;padding:0in 5.4pt 0in 5.4pt;
 height:31.15pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><b><u><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;
 mso-ascii-font-family:Calibri;mso-fareast-font-family:"Times New Roman";
 mso-hansi-font-family:Calibri;mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></u></b></p>
 </td>
 <td width=105 nowrap valign=bottom style='width:79.1pt;border-top:solid windowtext 1.5pt;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-top-alt:solid windowtext 1.5pt;mso-border-bottom-alt:solid windowtext .5pt;
 mso-border-right-alt:solid windowtext .5pt;padding:0in 5.4pt 0in 5.4pt;
 height:31.15pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><b><u><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;
 mso-ascii-font-family:Calibri;mso-fareast-font-family:"Times New Roman";
 mso-hansi-font-family:Calibri;mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></u></b></p>
 </td>
 <td width=633 nowrap valign=bottom style='width:474.6pt;border-top:solid windowtext 1.5pt;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.5pt;
 mso-border-top-alt:solid windowtext 1.5pt;mso-border-bottom-alt:solid windowtext .5pt;
 mso-border-right-alt:solid windowtext 1.5pt;padding:0in 5.4pt 0in 5.4pt;
 height:31.15pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><b><u><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;
 mso-ascii-font-family:Calibri;mso-fareast-font-family:"Times New Roman";
 mso-hansi-font-family:Calibri;mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></u></b></p>
 </td>
</tr>
<tr style='mso-yfti-irow:1;height:23.4pt'>
 <td width=137 valign=bottom style='width:102.45pt;border-top:none;border-left:
 solid windowtext 1.5pt;border-bottom:solid windowtext 1.0pt;border-right:
 solid windowtext 1.0pt;mso-border-left-alt:solid windowtext 1.5pt;mso-border-bottom-alt:
 solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;padding:
 0in 5.4pt 0in 5.4pt;height:23.4pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>Part Name<o:p></o:p></span></p>
 </td>
 <td width=107 valign=bottom style='width:80.0pt;border-top:none;border-left:
 none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:23.4pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>Part #<o:p></o:p></span></p>
 </td>
 <td width=209 valign=bottom style='width:156.7pt;border-top:none;border-left:
 none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:23.4pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>Part Type<o:p></o:p></span></p>
 </td>
 <td width=107 valign=bottom style='width:80.0pt;border-top:none;border-left:
 none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:23.4pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>Length<o:p></o:p></span></p>
 </td>
 <td width=105 valign=bottom style='width:79.1pt;border-top:none;border-left:
 none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:23.4pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>Strength/efficiency<o:p></o:p></span></p>
 </td>
 <td width=633 valign=bottom style='width:474.6pt;border-top:none;border-left:
 none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.5pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext 1.5pt;
 padding:0in 5.4pt 0in 5.4pt;height:23.4pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>Sequence and supplementary info<o:p></o:p></span></p>
 </td>
</tr>
<tr style='mso-yfti-irow:2;height:21.5pt'>
 <td width=137 valign=bottom style='width:102.45pt;border-top:none;border-left:
 solid windowtext 1.5pt;border-bottom:solid windowtext 1.0pt;border-right:
 solid windowtext 1.0pt;mso-border-left-alt:solid windowtext 1.5pt;mso-border-bottom-alt:
 solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;padding:
 0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>TetR<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>R0040<o:p></o:p></span></p>
 </td>
 <td width=209 nowrap valign=bottom style='width:156.7pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>Promoter<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>54<o:p></o:p></span></p>
 </td>
 <td width=105 nowrap valign=bottom style='width:79.1pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
 <td width=633 nowrap valign=bottom style='width:474.6pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.5pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext 1.5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:11.0pt'><a
 href="http://partsregistry.org/Part:BBa_R0040"><span style='mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri'>http://partsregistry.org/Part:BBa_R0040</span></a></span><u><span
 style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:Calibri;
 mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:blue'><o:p></o:p></span></u></p>
 </td>
</tr>
<tr style='mso-yfti-irow:3;height:21.5pt'>
 <td width=137 valign=bottom style='width:102.45pt;border-top:none;border-left:
 solid windowtext 1.5pt;border-bottom:solid windowtext 1.0pt;border-right:
 solid windowtext 1.0pt;mso-border-left-alt:solid windowtext 1.5pt;mso-border-bottom-alt:
 solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;padding:
 0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>PLuxR<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>R0065<o:p></o:p></span></p>
 </td>
 <td width=209 nowrap valign=bottom style='width:156.7pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>Promoter<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>97<o:p></o:p></span></p>
 </td>
 <td width=105 nowrap valign=bottom style='width:79.1pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
 <td width=633 nowrap valign=bottom style='width:474.6pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.5pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext 1.5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:11.0pt'><a
 href="http://partsregistry.org/Part:BBa_R0065"><span style='mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri'>http://partsregistry.org/Part:BBa_R0065</span></a></span><u><span
 style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:Calibri;
 mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:blue'><o:p></o:p></span></u></p>
 </td>
</tr>
<tr style='mso-yfti-irow:4;height:21.5pt'>
 <td width=137 valign=bottom style='width:102.45pt;border-top:none;border-left:
 solid windowtext 1.5pt;border-bottom:solid windowtext 1.0pt;border-right:
 solid windowtext 1.0pt;mso-border-left-alt:solid windowtext 1.5pt;mso-border-bottom-alt:
 solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;padding:
 0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>mLuxR<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>?<o:p></o:p></span></p>
 </td>
 <td width=209 nowrap valign=bottom style='width:156.7pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>Promoter<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
 <td width=105 nowrap valign=bottom style='width:79.1pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
 <td width=633 nowrap valign=bottom style='width:474.6pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.5pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext 1.5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>N/A<o:p></o:p></span></p>
 </td>
</tr>
<tr style='mso-yfti-irow:5;height:21.5pt'>
 <td width=137 valign=bottom style='width:102.45pt;border-top:none;border-left:
 solid windowtext 1.5pt;border-bottom:solid windowtext 1.0pt;border-right:
 solid windowtext 1.0pt;mso-border-left-alt:solid windowtext 1.5pt;mso-border-bottom-alt:
 solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;padding:
 0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>GFP<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>E0040<o:p></o:p></span></p>
 </td>
 <td width=209 nowrap valign=bottom style='width:156.7pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>Protein<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>720<o:p></o:p></span></p>
 </td>
 <td width=105 nowrap valign=bottom style='width:79.1pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>N/A<o:p></o:p></span></p>
 </td>
 <td width=633 nowrap valign=bottom style='width:474.6pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.5pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext 1.5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:11.0pt'><a
 href="http://partsregistry.org/Part:BBa_E0040:Design"><span style='mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri'>http://partsregistry.org/Part:BBa_E0040:Design</span></a></span><u><span
 style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:Calibri;
 mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:blue'><o:p></o:p></span></u></p>
 </td>
</tr>
<tr style='mso-yfti-irow:6;height:21.5pt'>
 <td width=137 valign=bottom style='width:102.45pt;border-top:none;border-left:
 solid windowtext 1.5pt;border-bottom:solid windowtext 1.0pt;border-right:
 solid windowtext 1.0pt;mso-border-left-alt:solid windowtext 1.5pt;mso-border-bottom-alt:
 solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;padding:
 0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>LuxI<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>C0061<o:p></o:p></span></p>
 </td>
 <td width=209 nowrap valign=bottom style='width:156.7pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>Protein<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>618<o:p></o:p></span></p>
 </td>
 <td width=105 nowrap valign=bottom style='width:79.1pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>N/A<o:p></o:p></span></p>
 </td>
 <td width=633 nowrap valign=bottom style='width:474.6pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.5pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext 1.5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:11.0pt'><a
 href="http://partsregistry.org/Part:BBa_C0061"><span style='mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri'>http://partsregistry.org/Part:BBa_C0061</span></a></span><u><span
 style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:Calibri;
 mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:blue'><o:p></o:p></span></u></p>
 </td>
</tr>
<tr style='mso-yfti-irow:7;height:21.5pt'>
 <td width=137 valign=bottom style='width:102.45pt;border-top:none;border-left:
 solid windowtext 1.5pt;border-bottom:solid windowtext 1.0pt;border-right:
 solid windowtext 1.0pt;mso-border-left-alt:solid windowtext 1.5pt;mso-border-bottom-alt:
 solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;padding:
 0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>LuxR<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>C0062<o:p></o:p></span></p>
 </td>
 <td width=209 nowrap valign=bottom style='width:156.7pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>Protein<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>756<o:p></o:p></span></p>
 </td>
 <td width=105 nowrap valign=bottom style='width:79.1pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>N/A<o:p></o:p></span></p>
 </td>
 <td width=633 nowrap valign=bottom style='width:474.6pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.5pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext 1.5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:11.0pt'><a
 href="http://partsregistry.org/Part:BBa_C0062"><span style='mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri'>http://partsregistry.org/Part:BBa_C0062</span></a></span><u><span
 style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:Calibri;
 mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:blue'><o:p></o:p></span></u></p>
 </td>
</tr>
<tr style='mso-yfti-irow:8;height:21.5pt'>
 <td width=137 valign=bottom style='width:102.45pt;border-top:none;border-left:
 solid windowtext 1.5pt;border-bottom:solid windowtext 1.0pt;border-right:
 solid windowtext 1.0pt;mso-border-left-alt:solid windowtext 1.5pt;mso-border-bottom-alt:
 solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;padding:
 0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>aiiA<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>C0060<o:p></o:p></span></p>
 </td>
 <td width=209 nowrap valign=bottom style='width:156.7pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>Protein<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>786<o:p></o:p></span></p>
 </td>
 <td width=105 nowrap valign=bottom style='width:79.1pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>N/A<o:p></o:p></span></p>
 </td>
 <td width=633 nowrap valign=bottom style='width:474.6pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.5pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext 1.5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:11.0pt'><a
 href="http://partsregistry.org/Part:BBa_C0060"><span style='mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri'>http://partsregistry.org/Part:BBa_C0060</span></a></span><u><span
 style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:Calibri;
 mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:blue'><o:p></o:p></span></u></p>
 </td>
</tr>
<tr style='mso-yfti-irow:9;height:21.5pt'>
 <td width=137 valign=bottom style='width:102.45pt;border-top:none;border-left:
 solid windowtext 1.5pt;border-bottom:solid windowtext 1.0pt;border-right:
 solid windowtext 1.0pt;mso-border-left-alt:solid windowtext 1.5pt;mso-border-bottom-alt:
 solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;padding:
 0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>cI<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>C0051<o:p></o:p></span></p>
 </td>
 <td width=209 nowrap valign=bottom style='width:156.7pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>Protein<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
 <td width=105 nowrap valign=bottom style='width:79.1pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>N/A<o:p></o:p></span></p>
 </td>
 <td width=633 nowrap valign=bottom style='width:474.6pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.5pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext 1.5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:11.0pt'><a
 href="http://partsregistry.org/Part:BBa_C0051"><span style='mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri'>http://partsregistry.org/Part:BBa_C0051</span></a></span><u><span
 style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:Calibri;
 mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:blue'><o:p></o:p></span></u></p>
 </td>
</tr>
<tr style='mso-yfti-irow:10;height:21.5pt'>
 <td width=137 valign=bottom style='width:102.45pt;border-top:none;border-left:
 solid windowtext 1.5pt;border-bottom:solid windowtext 1.0pt;border-right:
 solid windowtext 1.0pt;mso-border-left-alt:solid windowtext 1.5pt;mso-border-bottom-alt:
 solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;padding:
 0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>B0034<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>B0034<o:p></o:p></span></p>
 </td>
 <td width=209 nowrap valign=bottom style='width:156.7pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>Ribosome binding site<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>12<o:p></o:p></span></p>
 </td>
 <td width=105 nowrap valign=bottom style='width:79.1pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>1<o:p></o:p></span></p>
 </td>
 <td width=633 nowrap valign=bottom style='width:474.6pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.5pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext 1.5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:11.0pt'><a
 href="http://partsregistry.org/Part:BBa_B0034"><span style='mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri'>http://partsregistry.org/Part:BBa_B0034</span></a></span><u><span
 style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:Calibri;
 mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:blue'><o:p></o:p></span></u></p>
 </td>
</tr>
<tr style='mso-yfti-irow:11;height:21.5pt'>
 <td width=137 valign=bottom style='width:102.45pt;border-top:none;border-left:
 solid windowtext 1.5pt;border-bottom:solid windowtext 1.0pt;border-right:
 solid windowtext 1.0pt;mso-border-left-alt:solid windowtext 1.5pt;mso-border-bottom-alt:
 solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;padding:
 0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>B0015<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>B0015<o:p></o:p></span></p>
 </td>
 <td width=209 nowrap valign=bottom style='width:156.7pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>Ribosome binding site<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>129<o:p></o:p></span></p>
 </td>
 <td width=105 nowrap valign=bottom style='width:79.1pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>0.98<o:p></o:p></span></p>
 </td>
 <td width=633 nowrap valign=bottom style='width:474.6pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.5pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext 1.5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:11.0pt'><a
 href="http://partsregistry.org/Part:BBa_B0015"><span style='mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri'>http://partsregistry.org/Part:BBa_B0015</span></a></span><u><span
 style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:Calibri;
 mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:blue'><o:p></o:p></span></u></p>
 </td>
</tr>
<tr style='mso-yfti-irow:12;height:21.5pt'>
 <td width=137 valign=bottom style='width:102.45pt;border-top:none;border-left:
 solid windowtext 1.5pt;border-bottom:solid windowtext 1.0pt;border-right:
 solid windowtext 1.0pt;mso-border-left-alt:solid windowtext 1.5pt;mso-border-bottom-alt:
 solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;padding:
 0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>B0031<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>B0031<o:p></o:p></span></p>
 </td>
 <td width=209 nowrap valign=bottom style='width:156.7pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>Ribosome binding site<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>14<o:p></o:p></span></p>
 </td>
 <td width=105 nowrap valign=bottom style='width:79.1pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>0.07<o:p></o:p></span></p>
 </td>
 <td width=633 nowrap valign=bottom style='width:474.6pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.5pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext 1.5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:11.0pt'><a
 href="http://partsregistry.org/Part:BBa_B0031"><span style='mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri'>http://partsregistry.org/Part:BBa_B0031</span></a></span><u><span
 style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:Calibri;
 mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:blue'><o:p></o:p></span></u></p>
 </td>
</tr>
<tr style='mso-yfti-irow:13;height:21.5pt'>
 <td width=137 valign=bottom style='width:102.45pt;border-top:none;border-left:
 solid windowtext 1.5pt;border-bottom:solid windowtext 1.0pt;border-right:
 solid windowtext 1.0pt;mso-border-left-alt:solid windowtext 1.5pt;mso-border-bottom-alt:
 solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;padding:
 0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
 <td width=209 nowrap valign=bottom style='width:156.7pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
 <td width=105 nowrap valign=bottom style='width:79.1pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
 <td width=633 nowrap valign=bottom style='width:474.6pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.5pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext 1.5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
</tr>
<tr style='mso-yfti-irow:14;height:21.5pt'>
 <td width=137 valign=bottom style='width:102.45pt;border-top:none;border-left:
 solid windowtext 1.5pt;border-bottom:solid windowtext 1.0pt;border-right:
 solid windowtext 1.0pt;mso-border-left-alt:solid windowtext 1.5pt;mso-border-bottom-alt:
 solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;padding:
 0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><b><u><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;
 mso-ascii-font-family:Calibri;mso-fareast-font-family:"Times New Roman";
 mso-hansi-font-family:Calibri;mso-bidi-font-family:Calibri;color:black'>ULB
 Brussels<o:p></o:p></span></u></b></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
 <td width=209 nowrap valign=bottom style='width:156.7pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:11.0pt'><a
 href="http://2009.igem.org/Team:ULB-Brussels"><span style='mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri'>http://2009.igem.org/Team:ULB-Brussels</span></a></span><u><span
 style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:Calibri;
 mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:blue'><o:p></o:p></span></u></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
 <td width=105 nowrap valign=bottom style='width:79.1pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
 <td width=633 nowrap valign=bottom style='width:474.6pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.5pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext 1.5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
</tr>
<tr style='mso-yfti-irow:15;height:21.5pt'>
 <td width=137 valign=bottom style='width:102.45pt;border-top:none;border-left:
 solid windowtext 1.5pt;border-bottom:solid windowtext 1.0pt;border-right:
 solid windowtext 1.0pt;mso-border-left-alt:solid windowtext 1.5pt;mso-border-bottom-alt:
 solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;padding:
 0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>LacI Promoter<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>R0011<o:p></o:p></span></p>
 </td>
 <td width=209 nowrap valign=bottom style='width:156.7pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>Promoter<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>55<o:p></o:p></span></p>
 </td>
 <td width=105 nowrap valign=bottom style='width:79.1pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
 <td width=633 nowrap valign=bottom style='width:474.6pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.5pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext 1.5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:11.0pt'><a
 href="http://partsregistry.org/Part:BBa_R0011"><span style='mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri'>http://partsregistry.org/Part:BBa_R0011</span></a></span><u><span
 style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:Calibri;
 mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:blue'><o:p></o:p></span></u></p>
 </td>
</tr>
<tr style='mso-yfti-irow:16;height:37.6pt'>
 <td width=137 valign=bottom style='width:102.45pt;border-top:none;border-left:
 solid windowtext 1.5pt;border-bottom:solid windowtext 1.0pt;border-right:
 solid windowtext 1.0pt;mso-border-left-alt:solid windowtext 1.5pt;mso-border-bottom-alt:
 solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;padding:
 0in 5.4pt 0in 5.4pt;height:37.6pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>cI repressed promoter<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:37.6pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>R0052<o:p></o:p></span></p>
 </td>
 <td width=209 nowrap valign=bottom style='width:156.7pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:37.6pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>Promoter<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:37.6pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>46<o:p></o:p></span></p>
 </td>
 <td width=105 nowrap valign=bottom style='width:79.1pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:37.6pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
 <td width=633 nowrap valign=bottom style='width:474.6pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.5pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext 1.5pt;
 padding:0in 5.4pt 0in 5.4pt;height:37.6pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:11.0pt'><a
 href="http://partsregistry.org/Part:BBa_R0052"><span style='mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri'>http://partsregistry.org/Part:BBa_R0052</span></a></span><u><span
 style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:Calibri;
 mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:blue'><o:p></o:p></span></u></p>
 </td>
</tr>
<tr style='mso-yfti-irow:17;height:16.2pt'>
 <td width=137 valign=bottom style='width:102.45pt;border-top:none;border-left:
 solid windowtext 1.5pt;border-bottom:solid windowtext 1.0pt;border-right:
 solid windowtext 1.0pt;mso-border-left-alt:solid windowtext 1.5pt;mso-border-bottom-alt:
 solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;padding:
 0in 5.4pt 0in 5.4pt;height:16.2pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>HSL/P22 Hybrid promoter<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:16.2pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>K145150<o:p></o:p></span></p>
 </td>
 <td width=209 nowrap valign=bottom style='width:156.7pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:16.2pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>Promoter<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:16.2pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>66<o:p></o:p></span></p>
 </td>
 <td width=105 nowrap valign=bottom style='width:79.1pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:16.2pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
 <td width=633 nowrap valign=bottom style='width:474.6pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.5pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext 1.5pt;
 padding:0in 5.4pt 0in 5.4pt;height:16.2pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:11.0pt'><a
 href="http://partsregistry.org/Part:BBa_K145150"><span style='mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri'>http://partsregistry.org/Part:BBa_K145150</span></a></span><u><span
 style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:Calibri;
 mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:blue'><o:p></o:p></span></u></p>
 </td>
</tr>
<tr style='mso-yfti-irow:18;height:.3in'>
 <td width=137 valign=bottom style='width:102.45pt;border-top:none;border-left:
 solid windowtext 1.5pt;border-bottom:solid windowtext 1.0pt;border-right:
 solid windowtext 1.0pt;mso-border-left-alt:solid windowtext 1.5pt;mso-border-bottom-alt:
 solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;padding:
 0in 5.4pt 0in 5.4pt;height:.3in'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>LuxR/HSL promoter<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:.3in'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>R0062<o:p></o:p></span></p>
 </td>
 <td width=209 nowrap valign=bottom style='width:156.7pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:.3in'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>Promoter<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:.3in'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>55<o:p></o:p></span></p>
 </td>
 <td width=105 nowrap valign=bottom style='width:79.1pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:.3in'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
 <td width=633 nowrap valign=bottom style='width:474.6pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.5pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext 1.5pt;
 padding:0in 5.4pt 0in 5.4pt;height:.3in'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:11.0pt'><a
 href="http://partsregistry.org/Part:BBa_R0062"><span style='mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri'>http://partsregistry.org/Part:BBa_R0062</span></a></span><u><span
 style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:Calibri;
 mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:blue'><o:p></o:p></span></u></p>
 </td>
</tr>
<tr style='mso-yfti-irow:19;height:21.5pt'>
 <td width=137 valign=bottom style='width:102.45pt;border-top:none;border-left:
 solid windowtext 1.5pt;border-bottom:solid windowtext 1.0pt;border-right:
 solid windowtext 1.0pt;mso-border-left-alt:solid windowtext 1.5pt;mso-border-bottom-alt:
 solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;padding:
 0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>HfsG<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>K196002<o:p></o:p></span></p>
 </td>
 <td width=209 nowrap valign=bottom style='width:156.7pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>Protein<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>933<o:p></o:p></span></p>
 </td>
 <td width=105 nowrap valign=bottom style='width:79.1pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
 <td width=633 nowrap valign=bottom style='width:474.6pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.5pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext 1.5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:11.0pt'><a
 href="http://partsregistry.org/Part:BBa_K196002"><span style='mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri'>http://partsregistry.org/Part:BBa_K196002</span></a></span><u><span
 style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:Calibri;
 mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:blue'><o:p></o:p></span></u></p>
 </td>
</tr>
<tr style='mso-yfti-irow:20;height:21.5pt'>
 <td width=137 valign=bottom style='width:102.45pt;border-top:none;border-left:
 solid windowtext 1.5pt;border-bottom:solid windowtext 1.0pt;border-right:
 solid windowtext 1.0pt;mso-border-left-alt:solid windowtext 1.5pt;mso-border-bottom-alt:
 solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;padding:
 0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>HfsH<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>K196003<o:p></o:p></span></p>
 </td>
 <td width=209 nowrap valign=bottom style='width:156.7pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>Protein<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>777<o:p></o:p></span></p>
 </td>
 <td width=105 nowrap valign=bottom style='width:79.1pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
 <td width=633 nowrap valign=bottom style='width:474.6pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.5pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext 1.5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:11.0pt'><a
 href="http://partsregistry.org/Part:BBa_K196003"><span style='mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri'>http://partsregistry.org/Part:BBa_K196003</span></a></span><u><span
 style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:Calibri;
 mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:blue'><o:p></o:p></span></u></p>
 </td>
</tr>
<tr style='mso-yfti-irow:21;height:29.75pt'>
 <td width=137 valign=bottom style='width:102.45pt;border-top:none;border-left:
 solid windowtext 1.5pt;border-bottom:solid windowtext 1.0pt;border-right:
 solid windowtext 1.0pt;mso-border-left-alt:solid windowtext 1.5pt;mso-border-bottom-alt:
 solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;padding:
 0in 5.4pt 0in 5.4pt;height:29.75pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>parE<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:29.75pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>?<o:p></o:p></span></p>
 </td>
 <td width=209 nowrap valign=bottom style='width:156.7pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:29.75pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>Protein<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:29.75pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
 <td width=105 nowrap valign=bottom style='width:79.1pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:29.75pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
 <td width=633 valign=bottom style='width:474.6pt;border-top:none;border-left:
 none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.5pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext 1.5pt;
 padding:0in 5.4pt 0in 5.4pt;height:29.75pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>No biobrick part information but
 supplementary information on its function can be found here<span
 style='mso-spacerun:yes'>    </span><u>http://www.ncbi.nlm.nih.gov/pubmed/12010492</u><o:p></o:p></span></p>
 </td>
</tr>
<tr style='mso-yfti-irow:22;height:21.5pt'>
 <td width=137 valign=bottom style='width:102.45pt;border-top:none;border-left:
 solid windowtext 1.5pt;border-bottom:solid windowtext 1.0pt;border-right:
 solid windowtext 1.0pt;mso-border-left-alt:solid windowtext 1.5pt;mso-border-bottom-alt:
 solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;padding:
 0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
 <td width=209 nowrap valign=bottom style='width:156.7pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
 <td width=105 nowrap valign=bottom style='width:79.1pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
 <td width=633 nowrap valign=bottom style='width:474.6pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.5pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext 1.5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
</tr>
<tr style='mso-yfti-irow:23;height:22.05pt'>
 <td width=137 valign=bottom style='width:102.45pt;border-top:none;border-left:
 solid windowtext 1.5pt;border-bottom:solid windowtext 1.0pt;border-right:
 solid windowtext 1.0pt;mso-border-left-alt:solid windowtext 1.5pt;mso-border-bottom-alt:
 solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;padding:
 0in 5.4pt 0in 5.4pt;height:22.05pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><b><u><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;
 mso-ascii-font-family:Calibri;mso-fareast-font-family:"Times New Roman";
 mso-hansi-font-family:Calibri;mso-bidi-font-family:Calibri;color:black'>University
 of Edinburgh<o:p></o:p></span></u></b></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:22.05pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
 <td width=209 nowrap valign=bottom style='width:156.7pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:22.05pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:11.0pt'><a
 href="http://2008.igem.org/Team:Edinburgh"><span style='mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri'>http://2008.igem.org/Team:Edinburgh</span></a></span><u><span
 style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:Calibri;
 mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:blue'><o:p></o:p></span></u></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:22.05pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
 <td width=105 nowrap valign=bottom style='width:79.1pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:22.05pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
 <td width=633 nowrap valign=bottom style='width:474.6pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.5pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext 1.5pt;
 padding:0in 5.4pt 0in 5.4pt;height:22.05pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
</tr>
<tr style='mso-yfti-irow:24;height:21.5pt'>
 <td width=137 valign=bottom style='width:102.45pt;border-top:none;border-left:
 solid windowtext 1.5pt;border-bottom:solid windowtext 1.0pt;border-right:
 solid windowtext 1.0pt;mso-border-left-alt:solid windowtext 1.5pt;mso-border-bottom-alt:
 solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;padding:
 0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>cenA<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>K118023<o:p></o:p></span></p>
 </td>
 <td width=209 nowrap valign=bottom style='width:156.7pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>Protein<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>1353<o:p></o:p></span></p>
 </td>
 <td width=105 nowrap valign=bottom style='width:79.1pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
 <td width=633 nowrap valign=bottom style='width:474.6pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.5pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext 1.5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:11.0pt'><a
 href="http://partsregistry.org/Part:BBa_K118023"><span style='mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri'>http://partsregistry.org/Part:BBa_K118023</span></a></span><u><span
 style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:Calibri;
 mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:blue'><o:p></o:p></span></u></p>
 </td>
</tr>
<tr style='mso-yfti-irow:25;height:21.5pt'>
 <td width=137 valign=bottom style='width:102.45pt;border-top:none;border-left:
 solid windowtext 1.5pt;border-bottom:solid windowtext 1.0pt;border-right:
 solid windowtext 1.0pt;mso-border-left-alt:solid windowtext 1.5pt;mso-border-bottom-alt:
 solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;padding:
 0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>cex<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>K118022<o:p></o:p></span></p>
 </td>
 <td width=209 nowrap valign=bottom style='width:156.7pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>Protein<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>1461<o:p></o:p></span></p>
 </td>
 <td width=105 nowrap valign=bottom style='width:79.1pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
 <td width=633 nowrap valign=bottom style='width:474.6pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.5pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext 1.5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:11.0pt'><a
 href="http://partsregistry.org/Part:BBa_K118022"><span style='mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri'>http://partsregistry.org/Part:BBa_K118022</span></a></span><u><span
 style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:Calibri;
 mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:blue'><o:p></o:p></span></u></p>
 </td>
</tr>
<tr style='mso-yfti-irow:26;height:21.5pt'>
 <td width=137 valign=bottom style='width:102.45pt;border-top:none;border-left:
 solid windowtext 1.5pt;border-bottom:solid windowtext 1.0pt;border-right:
 solid windowtext 1.0pt;mso-border-left-alt:solid windowtext 1.5pt;mso-border-bottom-alt:
 solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;padding:
 0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>bgIX<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>K118028<o:p></o:p></span></p>
 </td>
 <td width=209 nowrap valign=bottom style='width:156.7pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>Protein<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>2280<o:p></o:p></span></p>
 </td>
 <td width=105 nowrap valign=bottom style='width:79.1pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
 <td width=633 nowrap valign=bottom style='width:474.6pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.5pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext 1.5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:11.0pt'><a
 href="http://partsregistry.org/Part:BBa_K118028"><span style='mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri'>http://partsregistry.org/Part:BBa_K118028</span></a></span><u><span
 style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:Calibri;
 mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:blue'><o:p></o:p></span></u></p>
 </td>
</tr>
<tr style='mso-yfti-irow:27;height:11.2pt'>
 <td width=137 valign=bottom style='width:102.45pt;border-top:none;border-left:
 solid windowtext 1.5pt;border-bottom:solid windowtext 1.0pt;border-right:
 solid windowtext 1.0pt;mso-border-left-alt:solid windowtext 1.5pt;mso-border-bottom-alt:
 solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;padding:
 0in 5.4pt 0in 5.4pt;height:11.2pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>SU1<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:11.2pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>?<o:p></o:p></span></p>
 </td>
 <td width=209 nowrap valign=bottom style='width:156.7pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:11.2pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>Protein<o:p></o:p></span></p>
 </td>
 <td width=107 valign=bottom style='width:80.0pt;border-top:none;border-left:
 none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:11.2pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>Sequence provided<o:p></o:p></span></p>
 </td>
 <td width=105 nowrap valign=bottom style='width:79.1pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:11.2pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
 <td width=633 nowrap valign=bottom style='width:474.6pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.5pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext 1.5pt;
 padding:0in 5.4pt 0in 5.4pt;height:11.2pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:11.0pt'><a
 href="http://2008.igem.org/Team:Edinburgh/SU1"><span style='mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri'>http://2008.igem.org/Team:Edinburgh/SU1</span></a></span><u><span
 style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:Calibri;
 mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:blue'><o:p></o:p></span></u></p>
 </td>
</tr>
<tr style='mso-yfti-irow:28;height:17.1pt'>
 <td width=137 valign=bottom style='width:102.45pt;border-top:none;border-left:
 solid windowtext 1.5pt;border-bottom:solid windowtext 1.0pt;border-right:
 solid windowtext 1.0pt;mso-border-left-alt:solid windowtext 1.5pt;mso-border-bottom-alt:
 solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;padding:
 0in 5.4pt 0in 5.4pt;height:17.1pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>ISO2<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:17.1pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>?<o:p></o:p></span></p>
 </td>
 <td width=209 nowrap valign=bottom style='width:156.7pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:17.1pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>Protein<o:p></o:p></span></p>
 </td>
 <td width=107 valign=bottom style='width:80.0pt;border-top:none;border-left:
 none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:17.1pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>Sequence provided<o:p></o:p></span></p>
 </td>
 <td width=105 nowrap valign=bottom style='width:79.1pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:17.1pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
 <td width=633 nowrap valign=bottom style='width:474.6pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.5pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext 1.5pt;
 padding:0in 5.4pt 0in 5.4pt;height:17.1pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:11.0pt'><a
 href="http://2008.igem.org/Team:Edinburgh/ISO2"><span style='mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri'>http://2008.igem.org/Team:Edinburgh/ISO2</span></a></span><u><span
 style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:Calibri;
 mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:blue'><o:p></o:p></span></u></p>
 </td>
</tr>
<tr style='mso-yfti-irow:29;height:.2in'>
 <td width=137 valign=bottom style='width:102.45pt;border-top:none;border-left:
 solid windowtext 1.5pt;border-bottom:solid windowtext 1.0pt;border-right:
 solid windowtext 1.0pt;mso-border-left-alt:solid windowtext 1.5pt;mso-border-bottom-alt:
 solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;padding:
 0in 5.4pt 0in 5.4pt;height:.2in'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>GBSS<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:.2in'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>?<o:p></o:p></span></p>
 </td>
 <td width=209 nowrap valign=bottom style='width:156.7pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:.2in'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>Protein<o:p></o:p></span></p>
 </td>
 <td width=107 valign=bottom style='width:80.0pt;border-top:none;border-left:
 none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:.2in'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>Sequence provided<o:p></o:p></span></p>
 </td>
 <td width=105 nowrap valign=bottom style='width:79.1pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:.2in'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
 <td width=633 nowrap valign=bottom style='width:474.6pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.5pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext 1.5pt;
 padding:0in 5.4pt 0in 5.4pt;height:.2in'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:11.0pt'><a
 href="http://2008.igem.org/Team:Edinburgh/GBS1"><span style='mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri'>http://2008.igem.org/Team:Edinburgh/GBS1</span></a></span><u><span
 style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:Calibri;
 mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:blue'><o:p></o:p></span></u></p>
 </td>
</tr>
<tr style='mso-yfti-irow:30;height:.25in'>
 <td width=137 valign=bottom style='width:102.45pt;border-top:none;border-left:
 solid windowtext 1.5pt;border-bottom:solid windowtext 1.0pt;border-right:
 solid windowtext 1.0pt;mso-border-left-alt:solid windowtext 1.5pt;mso-border-bottom-alt:
 solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;padding:
 0in 5.4pt 0in 5.4pt;height:.25in'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>glgC<o:p></o:p></span></p>
 </td>
 <td width=107 valign=bottom style='width:80.0pt;border-top:none;border-left:
 none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:.25in'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>K118015/K118016<o:p></o:p></span></p>
 </td>
 <td width=209 nowrap valign=bottom style='width:156.7pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:.25in'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>Protein<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:.25in'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>1299<o:p></o:p></span></p>
 </td>
 <td width=105 nowrap valign=bottom style='width:79.1pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:.25in'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
 <td width=633 nowrap valign=bottom style='width:474.6pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.5pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext 1.5pt;
 padding:0in 5.4pt 0in 5.4pt;height:.25in'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:11.0pt'><a
 href="http://partsregistry.org/Part:BBa_K118015"><span style='mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri'>http://partsregistry.org/Part:BBa_K118015</span></a></span><u><span
 style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:Calibri;
 mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:blue'><o:p></o:p></span></u></p>
 </td>
</tr>
<tr style='mso-yfti-irow:31;height:17.05pt'>
 <td width=137 valign=bottom style='width:102.45pt;border-top:none;border-left:
 solid windowtext 1.5pt;border-bottom:solid windowtext 1.0pt;border-right:
 solid windowtext 1.0pt;mso-border-left-alt:solid windowtext 1.5pt;mso-border-bottom-alt:
 solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;padding:
 0in 5.4pt 0in 5.4pt;height:17.05pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>E <o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:17.05pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>?<o:p></o:p></span></p>
 </td>
 <td width=209 nowrap valign=bottom style='width:156.7pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:17.05pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>Protein<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:17.05pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
 <td width=105 nowrap valign=bottom style='width:79.1pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:17.05pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
 <td width=633 valign=bottom style='width:474.6pt;border-top:none;border-left:
 none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.5pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext 1.5pt;
 padding:0in 5.4pt 0in 5.4pt;height:17.05pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>Not an official biobrick part -
 supplementary information can be found here <u><span
 style='mso-spacerun:yes'> </span>http://jb.asm.org/cgi/content/abstract/171/8/4334</u><o:p></o:p></span></p>
 </td>
</tr>
<tr style='mso-yfti-irow:32;height:21.55pt'>
 <td width=137 valign=bottom style='width:102.45pt;border-top:none;border-left:
 solid windowtext 1.5pt;border-bottom:solid windowtext 1.0pt;border-right:
 solid windowtext 1.0pt;mso-border-left-alt:solid windowtext 1.5pt;mso-border-bottom-alt:
 solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;padding:
 0in 5.4pt 0in 5.4pt;height:21.55pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>comK<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.55pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>?<o:p></o:p></span></p>
 </td>
 <td width=209 nowrap valign=bottom style='width:156.7pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.55pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>Protein<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.55pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
 <td width=105 nowrap valign=bottom style='width:79.1pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.55pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
 <td width=633 valign=bottom style='width:474.6pt;border-top:none;border-left:
 none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.5pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext 1.5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.55pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>Not an official biobrick part -
 supplementary information can be found here <u>http://www3.davidson.edu/cms/Documents/Academics/Departments/InterdisciplinaryStudies/SimpsonSamanthaThesisOutline12-08pdf.pdf</u><o:p></o:p></span></p>
 </td>
</tr>
<tr style='mso-yfti-irow:33;height:21.5pt'>
 <td width=137 valign=bottom style='width:102.45pt;border-top:none;border-left:
 solid windowtext 1.5pt;border-bottom:solid windowtext 1.0pt;border-right:
 solid windowtext 1.0pt;mso-border-left-alt:solid windowtext 1.5pt;mso-border-bottom-alt:
 solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;padding:
 0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>PcstA<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>K118011<o:p></o:p></span></p>
 </td>
 <td width=209 nowrap valign=bottom style='width:156.7pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>Promoter<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>131<o:p></o:p></span></p>
 </td>
 <td width=105 nowrap valign=bottom style='width:79.1pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
 <td width=633 nowrap valign=bottom style='width:474.6pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.5pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext 1.5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:11.0pt'><a
 href="http://partsregistry.org/Part:BBa_K118011"><span style='mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri'>http://partsregistry.org/Part:BBa_K118011</span></a></span><u><span
 style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:Calibri;
 mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:blue'><o:p></o:p></span></u></p>
 </td>
</tr>
<tr style='mso-yfti-irow:34;height:21.5pt'>
 <td width=137 valign=bottom style='width:102.45pt;border-top:none;border-left:
 solid windowtext 1.5pt;border-bottom:solid windowtext 1.0pt;border-right:
 solid windowtext 1.0pt;mso-border-left-alt:solid windowtext 1.5pt;mso-border-bottom-alt:
 solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;padding:
 0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>PcomK<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
 <td width=209 nowrap valign=bottom style='width:156.7pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>Promoter<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
 <td width=105 nowrap valign=bottom style='width:79.1pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
 <td width=633 nowrap valign=bottom style='width:474.6pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.5pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext 1.5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>Not an official biobrick part <o:p></o:p></span></p>
 </td>
</tr>
<tr style='mso-yfti-irow:35;height:21.5pt'>
 <td width=137 valign=bottom style='width:102.45pt;border-top:none;border-left:
 solid windowtext 1.5pt;border-bottom:solid windowtext 1.0pt;border-right:
 solid windowtext 1.0pt;mso-border-left-alt:solid windowtext 1.5pt;mso-border-bottom-alt:
 solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;padding:
 0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>Plac<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>J33207<o:p></o:p></span></p>
 </td>
 <td width=209 nowrap valign=bottom style='width:156.7pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>Promoter<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>600<o:p></o:p></span></p>
 </td>
 <td width=105 nowrap valign=bottom style='width:79.1pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
 <td width=633 nowrap valign=bottom style='width:474.6pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.5pt;
 mso-border-bottom-alt:solid windowtext .5pt;mso-border-right-alt:solid windowtext 1.5pt;
 padding:0in 5.4pt 0in 5.4pt;height:21.5pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:11.0pt'><a
 href="http://partsregistry.org/Part:BBa_J33207"><span style='mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri'>http://partsregistry.org/Part:BBa_J33207</span></a></span><u><span
 style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:Calibri;
 mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:blue'><o:p></o:p></span></u></p>
 </td>
</tr>
<tr style='mso-yfti-irow:36;mso-yfti-lastrow:yes;height:22.55pt'>
 <td width=137 valign=bottom style='width:102.45pt;border-top:none;border-left:
 solid windowtext 1.5pt;border-bottom:solid windowtext 1.5pt;border-right:
 solid windowtext 1.0pt;mso-border-left-alt:solid windowtext 1.5pt;mso-border-bottom-alt:
 solid windowtext 1.5pt;mso-border-right-alt:solid windowtext .5pt;padding:
 0in 5.4pt 0in 5.4pt;height:22.55pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>J15001<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.5pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext 1.5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:22.55pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>J15001<o:p></o:p></span></p>
 </td>
 <td width=209 nowrap valign=bottom style='width:156.7pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.5pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext 1.5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:22.55pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>Ribosome Binding Site<o:p></o:p></span></p>
 </td>
 <td width=107 nowrap valign=bottom style='width:80.0pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.5pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext 1.5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:22.55pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>10<o:p></o:p></span></p>
 </td>
 <td width=105 nowrap valign=bottom style='width:79.1pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.5pt;border-right:solid windowtext 1.0pt;
 mso-border-bottom-alt:solid windowtext 1.5pt;mso-border-right-alt:solid windowtext .5pt;
 padding:0in 5.4pt 0in 5.4pt;height:22.55pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:black'>&nbsp;<o:p></o:p></span></p>
 </td>
 <td width=633 nowrap valign=bottom style='width:474.6pt;border-top:none;
 border-left:none;border-bottom:solid windowtext 1.5pt;border-right:solid windowtext 1.5pt;
 padding:0in 5.4pt 0in 5.4pt;height:22.55pt'>
 <p class=MsoNormal style='margin-bottom:0in;margin-bottom:.0001pt;line-height:
 normal'><span style='font-size:8.0pt;mso-bidi-font-size:11.0pt'><a
 href="http://partsregistry.org/Part:BBa_J15001"><span style='mso-ascii-font-family:
 Calibri;mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri'>http://partsregistry.org/Part:BBa_J15001</span></a></span><u><span
 style='font-size:8.0pt;mso-bidi-font-size:10.0pt;mso-ascii-font-family:Calibri;
 mso-fareast-font-family:"Times New Roman";mso-hansi-font-family:Calibri;
 mso-bidi-font-family:Calibri;color:blue'><o:p></o:p></span></u></p>
 </td>
</tr>

</table>

<p class=MsoNormal><o:p>&nbsp;</o:p></p>

<p class=MsoNormal><o:p>&nbsp;</o:p></p>

<p class=MsoNormal>Following this step, was determining the presence of the parts used in these systems in GenoCAD’s database. Any parts not present in the database were created using GenoCAD’s custom part creation tools. From this point a library of the parts required to create these designs using GenoCAD. However, a number of caveats were initially observed with the program. </p>

<p class=MsoNormal>These included the inability to create multiple plasmids within the same design canvas. Also there is the inability to explicitly indicate relationship between parts comprising a single design. This is in part down to its nature as a sequence design tool predominantly. Also of note is the inability to place a single gene or multiple genes under the control of multiple promoters without user creation of composite parts. The latter issue being a result of the constraints involved in sequence design to prevent less experienced designers making fatal mistakes. </p>

<p class=MsoNormal>GenoCAD provides a structured system for the design of synthetic sequences. Based on the use of a set of “grammars” and a hierarchical construction workflow, GenoCAD constrains the possible structure of the synthetic sequences generated to a set of structures that could be functional in a biological context.</p>

<p class=MsoNormal><o:p>&nbsp;</o:p></p>

<p class=MsoNormal>The first option presented to the user after the creation of their library of parts is to select the vector and flanking regions for the coding areas of the plasmid corresponding to their synthetic construct. Selection of the vector leads to a number of further options for the make-up of the expression cassette which in turn leads to further options. In essence, the construction metaphor is an inverted tree with an increase in options from top to bottom. After designing the basic structure of their synthetic construct the specific content for each type of part chosen is filled in. This content is what conveys the behavior of the actual system, more so than the structure of the system.<span style='mso-spacerun:yes'>  </span></p>

<p class=MsoNormal>The output of this tool is two-fold, the sequence of the synthetic system created and a graphical representation of the system created. An example system with a single negative feedback loop was created. GFP would be the primary output of this design, the levels of which are regulated by the levels of co-produced cI repressor protein. cI repressor protein would act on the cI repressor upstream of both the cI protein gene and GFP genes. </p>

<p class=MsoNormal style='text-indent:.5in'><span style='mso-no-proof:yes'><v:shapetype

id="_x0000_t75" coordsize="21600,21600" o:spt="75" o:preferrelative="t"
path="m@4@5l@4@11@9@11@9@5xe" filled="f" stroked="f">
<v:stroke joinstyle="miter"/>
<v:formulas>
 <v:f eqn="if lineDrawn pixelLineWidth 0"/>
 <v:f eqn="sum @0 1 0"/>
 <v:f eqn="sum 0 0 @1"/>
 <v:f eqn="prod @2 1 2"/>
 <v:f eqn="prod @3 21600 pixelWidth"/>
 <v:f eqn="prod @3 21600 pixelHeight"/>
 <v:f eqn="sum @0 0 1"/>
 <v:f eqn="prod @6 1 2"/>
 <v:f eqn="prod @7 21600 pixelWidth"/>
 <v:f eqn="sum @8 21600 0"/>
 <v:f eqn="prod @7 21600 pixelHeight"/>
 <v:f eqn="sum @10 21600 0"/>
</v:formulas>
<v:path o:extrusionok="f" gradientshapeok="t" o:connecttype="rect"/>
<o:lock v:ext="edit" aspectratio="t"/>

</v:shapetype><v:shape id="_x0000_i1026" type="#_x0000_t75" alt="image 1.png"

style='width:732pt;height:111.75pt;visibility:visible;mso-wrap-style:square'>
<v:imagedata src="GenoCAD%20workflow%20and%20tutorial_files/image002.png"
 o:title="image 1"/>

</v:shape></span></p>

<p class=MsoNormal><o:p>&nbsp;</o:p></p>

<p class=MsoNormal style='line-height:normal'><span style='mso-no-proof:yes'><v:shape

id="Picture_x0020_1" o:spid="_x0000_i1025" type="#_x0000_t75" style='width:732pt;
height:112.5pt;visibility:visible;mso-wrap-style:square' o:bordertopcolor="black"
o:borderleftcolor="black" o:borderbottomcolor="black" o:borderrightcolor="black">
<v:imagedata src="GenoCAD%20workflow%20and%20tutorial_files/image001.png"
 o:title=""/>
<w:bordertop type="single" width="16"/>
<w:borderleft type="single" width="16"/>
<w:borderbottom type="single" width="16"/>
<w:borderright type="single" width="16"/>

</v:shape></span></p>

<p class=MsoNormal><u>Diagram of example system.<o:p></o:p></u></p>

<p class=MsoNormal><u><o:p><span style='text-decoration:none'>&nbsp;</span></o:p></u></p>

<p class=MsoNormal>The sequence corresponding to this construct as provided by GenoCAD can be found below:</p>

<p class=MsoNormal>{ggatcctaactcgaggttacattgtcgatctgttcatggtgaacagctttaaatgcaccaaaaactcgtaaaagctctgatgtatctatcttttttacaccgttttcatctgtgcatatggacagttttccctttgatatctaacggtgaacagttgttctacttttgtttgttagtcttgatgcttcact<br> gatagatacaagagccataagaacctcagatccttccgtatttagccagtatgttctctagtgtgaattcgcggccgcttctagagttgacaaacaagatacattgtatgaaaatacaagaaagtttgttgatactagagaaagaggagaaatactagagatgcgtaaaggagaagaact<br> tttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaa<br> tgctttgcgagatacccagatcatatgaaacagcatgactttttcaagtactagagaaagaggagaaatactagagatgagcacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccag<br> gaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttgcaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctactagagccaggcatcaaataaaacgaa<br> aggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagtagcggccgccctgcagg}</p>

<p class=MsoNormal><o:p>&nbsp;</o:p></p>

<p class=MsoNormal>However, the sequences for the proteins, corresponding to the major functional elements and actuators of the expected behavior of the system are not included in this output. The sequences of regulatory elements are provided however.</p>

<p class=MsoNormal><u><o:p><span style='text-decoration:none'>&nbsp;</span></o:p></u></p>

<p class=MsoNormal><o:p>&nbsp;</o:p></p>

<p class=MsoNormal>Modelling of the behavior of a system based on known parameters and experimental data on the individual parts/elements of the system is an important part of the design process. GenoCAD was created to aid in the design process and creation of sequences for the chemical synthesis of these constructs, it is less concerned with the ability to test and/or predict functionality of the created systems in vivo. Due to this inability of GenoCAD to model synthetic systems and the need for such capabilities, we shifted our focus to locating more capable software tools in terms of design and modeling.</p>

<p class=MsoNormal><o:p>&nbsp;</o:p></p>

<p class=MsoNormal><o:p>&nbsp;</o:p></p>

<p class=MsoNormal><o:p>&nbsp;</o:p></p>

</div>

</body>

</html>