Matt Gethers/CRI, Thailand/Specifications/M13 For

From OpenWetWare
Jump to: navigation, search

M13 For (47 bases upstream of HindIII site)

Sequence: 5' CGCCAGGGTTTTCCCAGTCACGAC 3'

LENGTH: 24

GC CONTENT: 62.5 %

MELT TEMP: 64.1 ºC

M13 pUC18 forward primer (5' end at 352 on pubmed L09136)

pUC18.gb

Stock Info

Lab Stock: 100 μM

Made personal stock 6/23/08:

Made personal stock 7/31/08: 1 μl lab stock in 99 μl water.