Koch Lab:Protocols/Sequences/Unzipping oligos

From OpenWetWare

Oligos for ligating onto the BstXI sticky end from PCR on pRL574 plasmid

Top adapter 1a - TCGA, ATCG

Oligo #1: Top adapter 1a - TCGA, ATCG 
Modification: 5' phosphate

Bottom adapter 1a - Biotin

Oligo #2: Bottom adapter 1a - Biotin
Modification: X = biotin-dT

Bottom adapter 1b - Biotin, CATG

Oligo #3: Bottom adapter 1b - Biotin, CATG
Modification: X = biotin-dT

Hairpin Adapter 1

Oligo #4: Hairpin Adapter 1
Modifications: X = biotin-dT  

Kochlab note: we also have slightly modified biotinylated versions of the above that are missing the T (due to an error in the way we ordered them).

Hairpin Adapter 2

Name:              Hairpin Adapter 2 -- NotI
Scale:             1 micromol
Modification:      X = biotinylated dT
Purification:      PAGE
Note:  This oligo is a self-complementary hairpin.

Top Adapter -- BstXI / SapI

Name:              Top Adapter -- BstXI / SapI
Scale:             200 nmol
Modification:      5'-phosphate
Purification:      OPC (Unless you think PAGE would significantly improve purity)

Mfold verification of hybridization with Bottom Adatper 1a: Image:New Top Strand Adapter.png


Sap Cap AGC

Name:              Sap Cap AGC
Scale:             200 nmol
Sequence 5' to 3': 5'-Phosphate- AGCGGCGACCTAGCGTAAGCTAGGTCGCC
Modification:      5'-P
Purification:      OPC

Image:09Aug28-18-38-04 1 (1).png