Knight:Evolving Reshmaverters/Promoter library design

Promoter library design

In progress!

Promoter architecture

                 -35                    -10        +1
                ______                 ______       _
----------------TTGACA-----------------TATAAT----- CA------------------- (consensus)
----------------TTGCTT-----------------TATAAT-GATT CATAAATTTGAGAGAGGAGTT (good promoter clearance?) [1]
----------------TTGACT-----------------GATACT------CA------------------- (repressible, low KON?)[2]

----------------TTGACCccacgcgtggg------TATAAT----- CA------------------- (operator site in position of maximum steric interference with RNAP)[3, 4, 5]
----------------TTGACA---------CccacgcgTGGGAT----- CA------------------- (operator site in position of maximum steric interference with RNAP)[3, 4, 5]

Constant promoter

                 -35                    -10        +1
                ______                 ______       _
tttatcaaaaagagtgTTGATCccacgcgtgggatatagGATACTtagattcataaatttgagagaggagtt (promoter9)
tttatcaaaaagagtgTTGACAtttttaagtcccacgcgTGGGATtagattcataaatttgagagaggagtt (promoter8)

Questions

1. Do I include too much extraneous sequence? These promoters are longer to reflect those found in papers.

Libraries

                 -35                    -10        +1
                ______                 ______       _
tttatcaaaaagagtgTTGNTCccacgcgtgggannnnnNATANTnnnnnncannnnnnnnnn (based on promoter9)
tttatcaaaaagagtgTTGACAnnnnnnnntcccacgcgTGGGATnnnnnncannnnnnnnnn (based on promoter8)
       nnnnnnnnnTTGNCAnnntcccacgcgcgtggGATANTnnnnnnca (based on BBa_R2000)

Questions

1. Are these promoters likely to be functional? Too much sequence diversity?
2. I potentially don't need to vary the -35 and -10 from consensus because I can still achieve a range of promoter strengths without changing them. [6]

Operator

 0 site operator: cccacgcgcgtggg (14bp)
-2 site operator: cccacgc  gtggg (12bp) (higher affinity)

Brainstorming

How could these regulatory regions be redesigned to be repressible?

Comments welcome

• Repressor sites tend to fall between the -35 and -10 regions and/or downstream of the -10 (around the +1). (Not upstream of the -35). [7, 8]
• Binding of the repressor dimer to the promoter may lead to DNA bending rendering binding of more dimers unfavorable. Perhaps a single binding site is preferable?
• The TG sequence at -16 is causing the regulatory regions to be too strong in the derepressed state. The RNA polymerase is "winning" the competition for binding with the repressor. Perhaps this dinucleotide should be removed. [9, 10]
• A high k_ON (rate of complex formation between RNA polymerase and promoter) correlates inversely with repressibility. High k_ON may result in RNAP outcompeting the repressor for the regulatory region binding. High regulatory region clearance rates enable strong transcription initiation and allow for repressor binding.[2]
• +1 base should be an A with 6-7 bases between end of -10 hexamer and +1. [1, 2]
• Use the -2 operator site because it binds the homodimer more tightly. (But it is less modular).

• How can we design promoters with low k_ON but high clearance rates for improved repressibility?
  • K_ON and promoter occupancy by RNAP is determined by the -35 and -10 hexamers. Closer to consensus sequences means high k_ON and more stable RNAP-promoter complexes. [11]
  • An AT rich region around the transcription start site may lead to better promoter clearance? [1, 11]

Existing promoters

The following promoters have been tested and are not repressible under my testing conditions.

Heterodimers:
                         -35                    -10
Promoter1 cacgtgtgcgtgggTTGACAcgtgtgcgtgggaagtcGATACTgagcaca
Promoter2*              TTGACAcgtgtgcgtgggaagtcGATACTtagattcacgtgtgcgtggg
Promoter3 cacgtgtgcgtgggTTGACAcgtgtgcgtgggaagtcGATACTtagattcacgtgtgcgtggg
Promoter4 cacgtgtgcgtgggTTGACAcacgtgtgcgtgggaatGATACTgagcaca
Promoter5               TTGACAcacgtgtgcgtgggaatGATACTtagattcacgtgtgcgtggg
Promoter6 cacgtgtgcgtgggTTGACAcacgtgtgcgtgggaatGATACTtagattcacgtgtgcgtggg

Homodimers:
                    -35                   -10
BBa_R2000 agtttattcTTGACAtggtcccacgcgcgtggGATACTacgtcag
BBa_R2001 agtttattcTTGACAtggtcatattacggtgaGATACTcccacgcgcgtggg
BBa_R2002 agtttattcTTGACAtggtcccacgcgcgtggGATACTcccacgcgcgtggg

These promoters are too weak under my testing conditions. (Some were not clonable).

Homodimers:
                            -35                    -10        +1
                           ______                 ______       _
BBa_R2108  tttatcaaaaagagtgTTGACAtttttaagtcccacgcgTGGGATtagattcataaatttgagagaggagtt
BBa_R2110  tttatcaaaaagagtgTTGACAtttttaagctcccacgcGTGGGTtagattcataaatttgagagaggagtt
BBa_R2112  tttatcaaaaagagtgTTGACAtttttaatcccacgcgtGGGAATtagattcataaatttgagagaggagtt
BBa_R2109  tttatcaaaaagagtgTTGATCccacgcgtgggatatagGATACTtagattcataaatttgagagaggagtt
BBa_R2111  tttatcaaaaagagtgTTGACTcccacgcgtgggaatagGATACTtagattcataaatttgagagaggagtt
BBa_R2113  tttatcaaaaagagtgTTGTCCcacgcgtgggactatagGATACTtagattcataaatttgagagaggagtt
BBa_R2114  tttatcaaaaagagtgTTGACTcccacgcgtgggaatagGATATTtagattcataaatttgagagaggagtt

References

Promoter design

1. Kammerer W, Deuschle U, Gentz R, and Bujard H. Functional dissection of Escherichia coli promoters: information in the transcribed region is involved in late steps of the overall process. EMBO J. 1986 Nov;5(11):2995-3000. DOI:10.1002/j.1460-2075.1986.tb04597.x |
2. Lanzer M and Bujard H. Promoters largely determine the efficiency of repressor action. Proc Natl Acad Sci U S A. 1988 Dec;85(23):8973-7. DOI:10.1073/pnas.85.23.8973 |
7. Collado-Vides J, Magasanik B, and Gralla JD. Control site location and transcriptional regulation in Escherichia coli. Microbiol Rev. 1991 Sep;55(3):371-94. DOI:10.1128/mr.55.3.371-394.1991 |
8. Gralla JD. Transcriptional control--lessons from an E. coli promoter data base. Cell. 1991 Aug 9;66(3):415-8. DOI:10.1016/0092-8674(81)90001-5 |
9. Burr T, Mitchell J, Kolb A, Minchin S, and Busby S. DNA sequence elements located immediately upstream of the -10 hexamer in Escherichia coli promoters: a systematic study. Nucleic Acids Res. 2000 May 1;28(9):1864-70. DOI:10.1093/nar/28.9.1864 |
10. Voskuil MI, Voepel K, and Chambliss GH. The -16 region, a vital sequence for the utilization of a promoter in Bacillus subtilis and Escherichia coli. Mol Microbiol. 1995 Jul;17(2):271-9. DOI:10.1111/j.1365-2958.1995.mmi_17020271.x |
11. Ellinger T, Behnke D, Bujard H, and Gralla JD. Stalling of Escherichia coli RNA polymerase in the +6 to +12 region in vivo is associated with tight binding to consensus promoter elements. J Mol Biol. 1994 Jun 17;239(4):455-65. DOI:10.1006/jmbi.1994.1388 |
12. Lutz R and Bujard H. Independent and tight regulation of transcriptional units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements. Nucleic Acids Res. 1997 Mar 15;25(6):1203-10. DOI:10.1093/nar/25.6.1203 |
13. Besse M, von Wilcken-Bergmann B, and Müller-Hill B. Synthetic lac operator mediates repression through lac repressor when introduced upstream and downstream from lac promoter. EMBO J. 1986 Jun;5(6):1377-81. DOI:10.1002/j.1460-2075.1986.tb04370.x |

Structures

3. Wolfe SA, Ramm EI, and Pabo CO. Combining structure-based design with phage display to create new Cys(2)His(2) zinc finger dimers. Structure. 2000 Jul 15;8(7):739-50. DOI:10.1016/s0969-2126(00)00161-1 |
4. Murakami KS, Masuda S, and Darst SA. Structural basis of transcription initiation: RNA polymerase holoenzyme at 4 A resolution. Science. 2002 May 17;296(5571):1280-4. DOI:10.1126/science.1069594 |
5. Murakami KS, Masuda S, Campbell EA, Muzzin O, and Darst SA. Structural basis of transcription initiation: an RNA polymerase holoenzyme-DNA complex. Science. 2002 May 17;296(5571):1285-90. DOI:10.1126/science.1069595 |

Promoter libraries

6. Hammer K, Mijakovic I, and Jensen PR. Synthetic promoter libraries--tuning of gene expression. Trends Biotechnol. 2006 Feb;24(2):53-5. DOI:10.1016/j.tibtech.2005.12.003 |
14. Alper H, Miyaoku K, and Stephanopoulos G. Characterization of lycopene-overproducing E. coli strains in high cell density fermentations. Appl Microbiol Biotechnol. 2006 Oct;72(5):968-74. DOI:10.1007/s00253-006-0357-y |
15. Fischer CR, Alper H, Nevoigt E, Jensen KL, and Stephanopoulos G. Response to Hammer et al.: Tuning genetic control--importance of thorough promoter characterization versus generating promoter diversity. Trends Biotechnol. 2006 Feb;24(2):55-6. DOI:10.1016/j.tibtech.2005.12.001 |