Kartzinel:Laboratory Protocols

From OpenWetWare
Jump to: navigation, search

All lab users must complete training requirements and consult with PI Tyler Kartzinel before beginning research in the lab.

General Guidelines

Equipment Use & Maintenance

Manual pipettes

Pipettes are vital to the quality of your work, and they are expensive. Practice good technique at all times. If you have not used a pipette before (or even if you have used them extensively in other labs), please adopt our general guidelines.

  • Avoid dropping pipettes. Place them gently in their holders when not in use.
  • Do not turn pipettes past their limits (crank them slowly when approaching limits).
  • Use pipettes for volumes near the center of their limit (e.g., do not use a 20-200 uL pipette to pipette 200 uL; use a 100-1000 uL pipette instead).
  • Use only filter tips for pipettes (only filter tips should be ordered for the lab).
  • If you notice a pipette is not working smoothly, pause your work and report it or ask for help cleaning it.

Repeating pipette

  • Use requires training from a senior member of the lab. [Reminders and helpful hints to be added.]

Biosafety Cabinet

  • Never assume the person before you did a good job cleaning and stowing the cabinet: use 10% bleach to clean surfaces and equipment (and rinse with cleaning ethanol), run the hood for 15-30 minutes with the UV light, and then finally turn off the hood.
  • Always clean and stow the cabinet after every use: properly secure solid/liquid waste, hang up pipettes, turn off equipment, use 10% bleach to clean surfaces and equipment (and rinse with cleaning ethanol), run the hood for 15-30 minutes with the UV light, and then finally turn off the hood.

Qubit

Waste Disposal

  • All chemicals (including boxes of zymo reagents) have a Brown University chemical inventory barcode on them. When empty, please remove the barcode and stick it to collection paper (taped to the side of the fume hood above the red liquid-waste collection bin).

Liquid waste

Solid waste

DNA sampling & extraction protocols

Zymo Soil & Fecal Mini Kits

This is the kit we use for most of our fecal DNA research. Please note that the company can change (and has historically refined) the protocol. For this reason, the wiki does not recapitulate information contained within the protocol. You must refer to the protocol from the box you are using to ensure you have the correct version. We simply provide helpful tips for organizing and maintaining the highest standards for your workflow.

Xpedition Buffer vs. Standard Buffer
[Details on why we choose one vs. the other; ordering numbers/information for colleagues to reference] ...

Preparing Lysis Tubes Prior to Sampling

  • We inventory and prepare sample lysis tubes prior to beginning fieldwork whenever possible.
  • Prepare tubes in the biosafety cabinet after proper preparation, which involves wiping all surfaces and equipment inside the cabinet with 10% bleach and running the UV light for 30 minutes (a kitchen timer is provided).
  • Use the repeating pipette to aliquot the required amount of buffer into your tubes.
  • A piece of aluminum foil (internal side up) can be placed on the workbench inside the cabinet to provide a clean surface where you can place your tube caps efficiently (internal side down to prevent aerosols and dust from settling inside).
  • When re-capping, really crank the caps back on because the O-rings have allowed leaks in the past.
  • Apply pre-labeled stickers with appropriately procured Quartzy inventory numbers. Stickers are available in the lab or from Fisher Scientific (Cat. No. 15930C). They must be laser printed.
  • Randomly select at least one tube per box to serve as the "blank" for the batch. Use sharpie to write the word "BLANK" in addition to the inventory number to avoid inadvertently filling it with a sample in the field. The blank field should also be included in the inventory number on Quartzy (‘TK####### (Extraction Blank)’).
  • Prefilled and labeled tubes can go back in the baggie for use in the field. Write your initials, the range of inventory numbers included in the bag, date filled, and batch number on the exterior of the bag. Make sure the same is written on the box containing the rest of the reagents and columns. This box can stay in the lab (for use when completing extractions).

Field Sampling Considerations

  • For many lab members, it will be possible to develop a research plan based on existing protocols. Specific protocols and standard operating procedures that have been used and approved in the lab can be found in our Lab Archives account and/or by consulting with Tyler. These protocols include details pertaining to sample handling, preservation, transport, permitting, etc.

Qiagen Plant Mini Kits

PCR protocols

Standard Primer Sets

Mammal Barcoding

1. Mitochondrial Control Region/D-Loop (Ntie et al., 2010)
Useful for identifying mammalian herbivores based on fecal DNA. Target size = 600-750 bp.

Primers (modifications from Hoelzel et al. 1991 and Shields & Kocher 1991):
N777 - TACACTGGTCTTGTAAACC
H16498 - CCTGAAGTAGGAACCAGATG

PCR Recipe: Amplitaq Gold II 20 μL.
Termocycler Program: Standard 48.

Plant Barcoding

1. Chloroplast trnL (Tablet et al. 1991)
Spans the trnL-P6 loop that is so widely used for DNA metabarcoding. Target size +/- 600 bp.

Primers
trnL(UAA)c - CGAAATCGGTAGACGCTACG
trnL(UAA)d - GGGGATAGAGGGACTTGAAC

PCR Recipe: NEB Taq 12.5 μL.
Termocycler Program: Standard 50.

Invertebrate Barcoding

Illumina Primer Sets

Recipes

NEB 12.5 μL

Reagents (final concentration) 1x reaction (μL) x-fold reaction (μL)
10X NEB Taq buffer without Mg 1.25
MgCl2 - 25 mM (2.5 mM final) 1.25
dNTPs (200 μM each) 1.00
Primer 1 - 10 μM (0.2 μM final) 0.25
Primer 2 - 10 μM (0.2 μM final) 0.25
BSA - mg/mL (0.1 mg/mL final) 0.10
DMSO (4% final) 0.05
Molecular grade water 6.28
NEB Taq 0.06
DNA template 2.00 Add AFTER aliquoting 10.5 μL to reaction wells


Amplitaq Gold II 20 uL

Reagents (final concentration) 1x reaction (μL) x-fold reaction (μL)
10X amplitaq gold II buffer without Mg 2.00
MgCl2 - 25 mM (2.5 mM final) 2.00
dNTPs (200 μM each) 1.60
Primer 1 - 10 μM (0.2 μM final) 0.40
Primer 2 - 10 μM (0.2 μM final) 0.40
BSA - mg/mL (0.1 mg/mL final) 0.17
DMSO (4% final) 0.08
Molecular grade water 11.25
Amplitaq Gold II 0.10
DNA template 2.00 Add AFTER aliquoting 18 μL to reaction wells


Thermocycling Protocols

  • All thermocycling protocols happen in our post-PCR room, and reactions stay there. No exceptions.
  • All thermocycling protocols include a heated lid (unless otherwise noted).
  • Note that a 4ºC overnight may cause condensation on the thermocycler's block. Please do not allow a hold to really be "Forever"...


1. Standard 48

  • Note that "48" denotes annealing temperature. Our "standard" protocols follow this general cycling regime.
Step Temp ºC Time
1 cycle 95ºC 10 min
35 cycles 94ºC 30 sec
48ºC 30 sec
72ºC 45 sec
1 cycle 72ºC 10 min
Hold 4ºC Forever


1. Standard 50

  • Note that "50" denotes annealing temperature. Our "standard" protocols follow this general cycling regime.
Step Temp ºC Time
1 cycle 95ºC 10 min
35 cycles 94ºC 30 sec
50ºC 30 sec
72ºC 45 sec
1 cycle 72ºC 10 min
Hold 4ºC Forever