Kai Yuet/Langer/ATM
Ataxia Telangiectasia Mutated (ATM)
(Includes Complementation Groups A, C and D)
Reference Access. Entrez Gene summary:
The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. Two transcript variants encoding different isoforms have been found for this gene.
ATM siRNA sequences from Human siRNA Database/Entrez Probe:
siRNA Sequence Transfection siRNA Source Location
(NM_000051)
Intra-S-Phase Checkpoint Activation by Direct CDK2 Inhibition
Mol Cell Biol]. 2004 July; 24(14): 6268–6277.
TAGAGCTACAGAACGAAAG Lipofectamine 2000 Chemically Synthesized 439-457
GAATGTGAACACCACCAAA Lipofectamine 2000 Chemically Synthesized 2279-2297
CTACACAAATATTGAGGAT Lipofectamine 2000 Chemically Synthesized 4105-4123
CTGTACTTCCATACTTGAT Lipofectamine 2000 Chemically Synthesized 5904-5922
ATR Couples FANCD2 Monoubiquitination to the DNA-damage Response.
Genes Dev. 2004 August 15; 18(16): 1958–1963.
AACATACTACTCAAAGACATT Lipofectamine 2000 Chemically Synthesized 812-832
MSH2 and ATR Form a Signaling Module and Regulate Two Branches of the Damage Response...
Proc Natl Acad Sci U S A. 2003 December 23; 100(26): 15387–15392.
AAGCACCAGUCCAGUAUUGGC Oligofectamine Chemically Synthesized 2402-2422
ATR-Dependent Phosphorylation of DNA-Dependent Protein Kinase Catalytic Subunit...
Mol Cell Biol. 2006 Oct;26(20):7520-8.
UGGUGCUAUUUACGGAGCU Oligofectamine Chemically Synthesized 784-802
ATM-dependent CHK2 Activation Induced by Anticancer Agent, Irofulven.
J Biol Chem. 2004 Sep 17;279(38):39584-92.
CATCTAGATCGGCATTCAG Oligofectamine Chemically Synthesized 509-527
Intra-S-Phase Checkpoint Activation by Direct CDK2 Inhibition.
ATR Couples FANCD2 Monoubiquitination to the DNA-damage Response.
MSH2 and ATR Form a Signaling Module and Regulate Two Branches of the Damage Response to DNA Methylation.
ATR-Dependent Phosphorylation of DNA-Dependent Protein Kinase Catalytic Subunit in Response to UV-Induced Replication Stress.
ATM-dependent CHK2 Activation Induced by Anticancer Agent, Irofulven.
ATM siRNA sequences derived from siDESIGN, which analyzes potential sequences from cDNA with eight additional criteria as elaborated in Rational siRNA Design for RNA Interference, Reynolds, A. et al. (2004), Nature Biotechnology 22, 326-330) and then performing a Nucleotide-Nucleotide BLAST (BLASTN) homology search of each to determine whether the target sequence has similarities in other genes:
siRNA Sequence Score Location GC Content Criterion
(NM_000051) 1 2 3 4 5 6 7 8
GTACCATAGGTGCCATTAA 9 3015-3033 42.11% + + + + + + +
TGAAGTCCATTGCTAATCA 9 4188-4206 36.84% + + + + + + + +
TGATAGAGCTACAGAACGA 8 436-454 42.11% + + + + + + + +
TGATTGTAGCAACATACTA 8 802-820 31.58% + + + + + + +
TCAGTGTGCGAGACAAGAA 8 1036-1054 47.37% + + + + + + +
TCTCAATCTTACACTACTA 8 1484-1502 31.58% + + + + + + +
CTGCGATTGTTAACATCAA 8 2795-2813 36.84% + + + + + + +
TGACCGTGGAGAAGTAGAA 8 2875-2893 47.37% + + + + + + +
CAATGGAAGATGATACTAA 8 2895-2813 31.58% + + + + + + +
Rational siRNA Design for RNA Interference.
ATM Antibodies for Western Blotting: At Biocompare.
ATM Probe for Northern Blotting:
Atm Expression Patterns Suggest a Contribution from the Peripheral Nervous System to the Phenotype of Ataxia–Telangiectasia.
Neuroscience, Volume 86, Issue 4 , 18 June 1998, Pages 1045-1054.
Forward Primer: (Sal I) CTCGTCGACGTGATGACCTGAGACAAGATGCTGTC
Reverse Primer: (Not I) CATAAGAATGCGGCCGCGCCATCCACAATATCTCTGGTGAGTC
Insert corresponds to nucleotides 8540-9136 (597 bp) of the ATM gene.