
From OpenWetWare
Jump to: navigation, search
Click here to visit our NEW WEBSITE
The content below is most likely out of date. We also have a new lean and mean openwetware area.

Gene Target Forward Primer Name Forward sequence Reverse Primer Name Reverse sequence product size purpose remarks
ribosomal S7 S7-A GGCGATCATCATCTACGTGC S7-B GTAGCTGCTGCAAACTTCGG 460bp semiquantitative RT-PCR Smeister
SP6 Promoter CATACGATTTAGGTGACACTATAG plasmid sequencing Smeister
T7 Promoter 20mer TAATACGACTCACTATAGGG T3 Promoter 23mer GCAATTAACCCTCACTAAAGGGA plasmid sequencing Smeister