Jessica Karen Wong/Notebook/2007-7-4

From OpenWetWare
Jump to: navigation, search
  • Took out overnight plates of I2056 transformation and saw no more colonies
  • PCR of I2055 also evaporated, redoing with 20ul and different tube
  • Got I2057 sequence which matches registry
  • Preped colonies 3, 4, and 6 of I2055 for sequencing
    • Minipreped and eluted with 30 ul pH 8.5 water instead of EB
    • used the 8-tubes, 2 samples of each colony, VR and VF
    • Mix: 2ul primer, x ul DNA to make b/t 200 and 500 ng, (10-x)ul water
    • Submitted order on dnalims.mit.edu
    • Building was locked so it's in the 4 degree
  • Digested T9002 with Mfe1
    • used buffer 4 and 11 ul T9002
  • Need scarring primers for I2056, I2057
    • I2056:
      • F: Same as I2055
      • R: same as I2055
    • I2057:
      • F: CTTAGTAG CAATTG TCACACAGGAAAGTACTAGATGGC (52.1)
      • R: same as I2055