Jessica Karen Wong/Notebook/2007-7-23

From OpenWetWare
Jump to: navigation, search
  • Minipreped I2055 for seq w/ VF and VR
  • Got some sequencing redo's back and I2055-3K3 which didn't work, nothing incredibly enlightening


Gradient I2056 PCR
  • Did a scarring/promoter insert PCR of I2056 on a gradient (50-56) w/ supermix
    • Ran a gel, all lanes looked good
    • Doing a 100ul PCR of I2056 at 51 overnight


  • Wrote up proposal for synthesis of I2055
  • Ordered new primers
    • CTTAGTAG GCGGCCGC ACTAGT G TCACACAGGAAAGTACTAGATGCG, BBbp_E0240_Fwd_Spe
    • CTTAGTAG GCGGCCGC TCTAGA G TCACACAGGAAAGTACTAGATGCG, BBbp_E0240_Fwd_Xba
    • CTTAGTAG GCGGCCGC ACTAGT G TCACACAGGAAAGTACTAGATGGC, BBbp_I2057_Fwd_Spe
    • CTTAGTAG GCGGCCGC TCTAGA G TCACACAGGAAAGTACTAGATGGC, BBbp_I2057_Fwd_Xba
    • TCAGCGAT GCGGCCGC ACTAGT A GTGCTCAGTATCTCTATCACTGATAGG, BBbp_R_Rev_Spe
    • CTTAGTAG GCGGCCGC TCTAG ATGCGTAAAGGAGAAGAACTTTTC, BBbp_I2055_Fwd_Xba
    • CTTAGTAG GCGGCCGC TCTAG ATGGCTTCCTCCGAAGACG, BBbp_I2056_Fwd_Xba