Jessica Karen Wong/Notebook/2007-7-13
From OpenWetWare
Jump to navigationJump to search

I2057
- Colony PCRed 12 10ul reactions w/ VF and VR, Taq and 1:30 ext time
- Ran gel (lad, 1-12, 1x DNA, 3x dilution DNA, water, lad)
- Got lots of too small bands
Sequencing
- E0240-1AK3 for E0040VR
- E0240-1AK3 for E0040VF
- T9002-3K3 for F2620 aka C62 VF
- T9002-3K3 for C62VR
E0240
- Redid gradient BB PCR with 3x dilution and pos control P1010-1AK3 at 52.7
I2055
- Redigested I2055 w/ pcr'ed in promoter w/ mfe and nsi
- used 4ul dna and buffer 2
- ligated I2055 M/N (not sure if contains promoter) and 3K3
- Transformed 3ul of ligation and plated
Ordered new I2056 primers to PCR in Promoter
- I2056_R0040_F 8mer.Mfe1.promoter+mix.part of RFP
- CTTAGTAG CAATTG tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactag ATGGCTTCCTCCGAAGACG (54.0)
Did an overnight colony PCR of
- T9002 1AK3 (9 samples)
- T9002 3K3 (16 samples)
- E0240 3K3 (20 samples)
- I2055 1AK3 (20 samples)