Jessica Karen Wong/Notebook/2007-6-27

From OpenWetWare
Jump to: navigation, search

To Do

  • PCR E0240
  • Colony PCR of Blue C (RBS tester on Chlor)
  • Order new T9002, I2055 primers
  • Re-transform other devices? Re-ligate?
  • Re-PCR I2055 w/ E0240R?


  • Did a 100ul preparatory PCR on E0240
  • PCR'ed I0255 on a gradient (12 10ul) with the E0240R primer
  • Did a colony PCR on the 7 colonies of blue C
  • Ran a gel of all PCR products and nothing but the ladders showed up
    • Made a new 200nM stock of DNTP's but apparently should have been 2.5 - probably why none of the PCR's worked


  • Heat-shocked the digest
  • Did a PCR cleanup
  • Stored in Measurement Kit box in -20


  • Religated B0032-J04650-1AC3 (green C) and B-J-1AT3 (green T)
  • Transformed 1ul and plated 100ul of the transformation

Designing Primers

cont'd from yesterday

    • Melting Temp 55.0

Bold is the tail, italics is the restriction site.

  • New Longer I2055
  • New Shorter I2055

Keep same tails?

  • Original I2055
    • Fwd- CTTAGTAG CAATTG tccctatcagtgatagagattgacatc melt 53.9
    • Rev- TCAGCGAT ATGCAT TATAAACGCAGAAAGGCCCAC melt 53.6 (is actually same primer as E0240R)