InternalLengthStandard

From OpenWetWare
Jump to: navigation, search


Internal Length Standard for DNA Capillary Electrophoresis


Overview

An internal length standard (ILS, DNA-Ladder, DNA Size Standard) is required for DNA fragment analysis on a capillary electrophoresis (CE) instrument. DNA segments with a known size are usually labelled with a separate fluorescent dye so that they show up in a separate channel of the CE instrument. From comparing the known sizes of the ILS to the unknown peak in an electropherogram it is possible to calculate the exact size of the unknown fragment.

Internal length standards can be purchased from Life Technologies, Promega and other vendors. However they are very expensive. Here we describe a method to create a homemade ILS with a simple PCR assay using just a single fluorescently labeled primer. The template is a highly conserved region of the human mitochondrial DNA where to our knowledge no single insertion or deletion has been observed. Therefore the template DNA can be easily obtained by a cheek swab of a lab person or any other source of human genomic DNA.

Materials

Primers

Primer Name Sequence rCRS position PCR Prod. Length Tm
ILSmt_3245_F_ROX or BMN5 GCCCGGTAATCGCATAAAAC 3245 61.2 °C
ILSmt_3304_60_R GTTAAGAAGAGGAATTGAACCTCTGAC 3304 60 61.1 °C
ILSmt_3324_80_R AGGTTGGCCATGGGTATGT 3324 80 60.1 °C
ILSmt_3344_100_R TGGGTACAATGAGGAGTAGGAGG 3344 100 61.6 °C
ILSmt_3364_120_R GAATGCCATTGCGATYAGAATG 3364 120 61.6 °C
ILSmt_3384_140_R TTTCGTTCGGTAAGCATTAGG 3384 140 59.3 °C
ILSmt_3404_160_R GTTGTATATRGCCTAGAATTTTTCGTTCG 3404 160 61.8 °C
ILSmt_3424_180_R AACGTTGGGGCCTTTGC 3424 180 62.0 °C
ILSmt_3444_200_R AGTAGCCCGTAGGGGCCTA 3444 200 61.0 °C
ILSmt_3469_225_R TTTTATGGCGTCAGCGAAG 3469 225 60.0 °C
ILSmt_3494_250_R GTTTTAGGGGCTCYTTGGTG 3494 250 58.7 °C
ILSmt_3519_275_R TAGAGGGTGATGGYAGATGTGG 3519 275 58.9 °C
ILSmt_3544_300_R GAGAGCTAAGGTCGGGGC 3544 300 59.9 °C
ILSmt_3569_325_R GGGTTCATAGTAGAAGDGCGATG 3569 325 59.3 °C
ILSmt_3594_350_R ACCAGGGGGTTGGGTATG 3594 350 60.4 °C
ILSmt_3619_375_R AAATAGGAGGCCTAGGTTGAGG 3619 375 60.0 °C
ILSmt_3644_400_R CGGCTAGGCTAGAGGTGGC 3644 400 62.3 °C
ILSmt_3669_425_R CACCCTGATCAGAGGATTGAGTAA 3669 425 61.7 °C
ILSmt_3694_450_R CAGGGCGTAGTTTGAGTTTGAT 3694 450 60.5 °C
ILSmt_3719_475_R GGGCTACTGCTCGYAGTG 3719 475 60.7 °C
ILSmt_3744_500_R AGGGTGACTTCATATGAGATTGTTTG 3744 500 61.7 °C
ILSmt_3769_525_R TAATGTTGATAGTAGAATGATGGCTAGG 3769 525 60.2 °C

The forward primer is labeled with a fluorescent dye. We've used ROX for the red channel or BMN5 for the infrared ("orange") channel. If this ladder is used on a stained agarose gel, then the forward primer can be unlabeled.

For each 50 μL PCR reaction:

  • 35 μL H2O
  • 5 μL 10X PCR buffer
  • 5 μL 2mM dNTPs (each)
  • 1.5 μL 50mM MgCl2
  • 1 μL 50μM ILSmt_3245_F primer, with fluorescent label
  • 1 μL 50μM antisense primer
  • 1 μL DNA template (human genomic DNA)
  • 0.5 μL TAQ DNA polyermerase

Procedure

  1. Set up a PCR reaction for each reverse primer in a separate PCR tube.
  2. Perform thermocycling program
    1. 95 °C 5 min
    2. 95 °C 30 s
    3. 60 °C 30 s
    4. 72 °C 1 min
    5. Repeat steps 2-4 a total of 30 times
    6. 72 °C 5 min
    7. 15 °C hold

After PCR mix the PCR products in equal ratios. We add double volumes for the 100s bands for easier recognition.

For capillary electrophoresis we use (less than) 0.5 μl ILS mixture per 10 μl formamide each injection.

Notes

In practice it is sufficient to only use the markers for 80, 100, 140, 200, 250, 300, 350, 400, 450, 500 and 525 bases.

ILS Example
ILS with BMN5 label

.

References

Relevant papers and books

  1. James W. Schumm, Promega Corporation (1997) Why Use a Size Marker and Allelic Ladders in STR Analysis? - Profiles in DNA 1(2) 11–13

Contact

  • Thomas Krahn (thomas (at) tkrahn.com)

or instead, discuss this protocol.