IGEM:PennState/Labbook/NoahJohnson/2007-6-11

From OpenWetWare
Jump to: navigation, search

June 11, 2007


XylA and XylB Primer (Temporarily Suspended)

3725940-3728788 Found on Ecocyc

<html><pre> TTACGCCATT AATGGCAGAA GTTGCTGATA GAGGCGACGG AACGTTTCTC GTCGTGGCTG ATAAGCGGCA TAACGCTGCG CATCTGGTAG ATGCGACTGT TCTAACGGTA GTTGCGGCAA CAATTCAATG AGCGATTTCT CTGGATTCGC CGCGATCTGC GCCAGCCTTG CTGCGCCCAG TGCTGGCCCC ACATCCCCCC CCGTACGGTA ATCGAGCTGC TGACCGCTGA TATCCGCCAG CATCTGACGC CAGTACTCAC TACGCGCCCC GCCCCCAATC AACGTAACAC TTTGCGGTTT AATACCGCAG GCATGCACGA CATCCATGCC ATCTGCCAGC GCATAACCCA CGCCTTCCAG CACTGCTCGC GCCAGTTCAT TGGGGCCATG TTGATGAGTC AAACCAAAGA AAACCCCCTT CGCCTGGGGA TTATTGTGTG GCGTACGCTC GCCGGAAAGA TAAGGCAGAA ACCAAACTGG CTCGGCACTT TCATCAGCCT GTTGAGCTGC AGCGATTAAA GCTGGGACAT TGCTCAGGCC GGTTAATTTC GCGGCCCAAT CCAGACACGA CGCTGCACTC AGCATCACAG ACATTAAATG CCAACGTTGC GGTAGCGCAT GGCAAAAGCT ATGTACGGCG CTTTCTGGCT TGCTTAAGAA CCCTTCGCTG ACAGCAAAAT AGACCCCCGA CGTCCCCAGC GATAACATTG CCTGATTAGC ATCAACCATT CCCACACCAA CTGCACCAGC TGCATTGTCG CCACCGCCTG CGACAACTGG CACCGTCGCC ATACCCCACG CTTTCGCAAC TTCAGGTAAC AAAGCACCAG TAATTTCGCT GCCTTCGTAT AATGCGGGCA TCTGGTCACG AGATAAGTCG CAAGCCTGCA GCATGACGTC ACTCCAGTCA CGCTTTGCGA CATCCAGCCA CATGGTGCCA GCTGCGTCAG ACATATCGCT GGCAAACTCC CCCGTCATAC GCAGACGCAA GTAATCTTTC GGTAATAATA CTTTGTCGAT TTGACGGAAT ATCTCCGGCT CATGCCGCTG AACCCATAGC AATTTAGGCG CAGTAAATCC GGGCATCATC AGGTTGCCGG TAATCACCCG CGATTGCGGA ACTCGCGCTT CCAGCAAAGT GCACTCTTGC GCACAGCGCC CGTCGTTCCA CAAAATGGCA GGGCGTAACA CCCGTTGCTG AGCATCCAGC AAGGTTGCTC CGTGCATCTG GCCGGCAATA CCCAATGCTT TAACGTCCTG CAGAGAATGC TGATCGCCCA GAGCTTTCAT TGCGCGATCA GTTGCCTGCC ACCACTGTTC CGGGTCTTGT TCCGACCAGA GTGGATGCGG GCGCGAAACG GTCAGCTTTT CCGTTTGCGC AGCAACCACC TCACCCTGCT CGTTGAGCAA AATAACTTTT ACGCCCGAGG TGCCAAGATC TATCCCGATA TACATATCGA TCGTTCCTTA AAAAAATGCC CGGTATCGCT ACCGATAACC GGGCCAACGG ACTGCACAGT TAGCCGTTAT TTGTCGAACA GATAATGGTT TACCAGATTT TCCAGTTGTT CCTGGCGACC ACTCTGATGC ACCGGAGACA AATGATGTTC CTGAGCATAT TTGGCTAAAT CTGCCAGTGA CATTTGGCCT TTCAGGATTT GCTGGCCCAA TTCGCTATTC CAGCCGGAAT AACGCTGCGC GATGCGTTTA TCCAGCTCGC CATCTTCAAT CATGCGCGCT GCAATTTTCA GCGCCAGTGC CATCGTATCC ATCGCGCCGA TATGACCGTA AAACAGATCA TATTTATCAG TACTTTGACG ACGTACTTTG GCATCGAAGT TCAGACCACC GGTGGTGAAA CCGCCTGCTT TGAGAATTTC ATACATCACC AGCGCATTCT CTTCCACACT GTTCGGGAAC TGGTCGGTGT CCCAGCCCAG TTGCGCATCG CCACGGTTGG CGTCGACAGA ACCGAACAGG CCAAGCGCAA TGGCGGTGGC TATTTCATGA TGGAAAGAGT GACCTGCCAG CGTCGCGTGG TTAGCTTCAA TGTTCAGTTT AATCTCTTTT TCCAGACCAA ACTGTTTCAG GAAGCCATAG ACCGTCGCGG CATCGTAATC ATATTGATGT TTGGTCGGTT CTTGCGGTTT CGGTTCGATA AGCAACGTGC CCTGGAAACC GATTTTATGT TTATGCTCAA CCACCATCTG CATAAAGCGG CCCAGTTGTT CACGCTCCTG ACGCAAGTCG GTATTTAACA GCGTTTCGTA ACCTTCACGA CCGCCCCACA GGACATAGTT TTCACCGCCC AATTTATGGG TTGCTTCCAT CGCTGTAACA ACTTGCGTTG CCGCCCAGCT GAAGACTTCA GGATCTGGGT TCGTCGCCGC ACCCGCGCCG TAGCGAGGGT TTGTAAAGCA GTTGGCCGTT CCCCACAGCA GCTTCACGCC GCTCTCTTCT TGCTTGCCTG CCAGGACATC AACCATTTGC GCAAAATTAT TGATGTACTC TTTTAACGAC GCGCCCTCAG GGGAAACATC CACATCGTGG AAGCAATAAA ATGGCACATG TAACTTGTGG AAAAACTCAA ATGCGACATC TGCTTTACGC TTCGCCAACG CCAGTGCCTC ACCAGGCTGC TGCCACGGAC GATTAAACGC CCCCACACCA AACATATCCG CCCCGTTCCA GCAGAAGGTG TGCCAGTAGC AGGCGGCAAA ACGCAAGTGC TCTTCCATAC GCTTACCCAA CACCAGTTCG TCGGGATTGT AGTGACGGAA TGCTAACGGG TTTGAGGATT TTGAGCCTTC ATAACGAACG CGATCGAGCT GGTCAAAATA GGCTTGCAT</pre></html>

Left side primer: gaattcgcggccgcttctagag TTACGCCATT AATGGCAGAA

Right side primer: ctgcagcggccgctactagta ATGCAAGCCT ATTTTGACCA


XylR Promoter Region Primer (Temporarily Suspended)

3732905-3733001 Found on Ecocyc

<html><pre>CAACCAAACG CCGTTCTTGA TTTTGATAAA AATTTTCTCA AAGCCGGTTA CGTATTACCG GTTTTGAGTT TTTGCATGAT TCAGCAGGAA AAGAACC</pre></html>

Left side primer: gaattcgcggccgcttctagag CAACCAAACG CCGTTCTTGA

Right side primer: ctgcagcggccgctactagta GGTTCTTTTC CTGCTGAATC

9:30-4 Group meeting 4-5:30