IGEM:PennState/Labbook/GalenLynch/2007-7-23

From OpenWetWare
Jump to: navigation, search

July 23rd, 2007: 10:40 - 5:10

Sequencing Primers for biobricks in PSB1A2

<html><pre>TACTAGTAGC GGCCGCTGCA GGCTTCCTCG CTCACTGACT CGCTGCGCTC GGTCGTTCGG CTGCGGCGAG CGGTATCAGC TCACTCAAAG GCGGTAATAC GGTTATCCAC AGAATCAGGG GATAACGCAG GAAAGAACAT GTGAGCAAAA GGCCAGCAAA AGGCCAGGAA CCGTAAAAAG GCCGCGTTGC TGGCGTTTTT CCATAGGCTC CGCCCCCCTG ACGAGCATCA CAAAAATCGA CGCTCAAGTC AGAGGTGGCG AAACCCGACA GGACTATAAA GATACCAGGC GTTTCCCCCT GGAAGCTCCC TCGTGCGCTC TCCTGTTCCG ACCCTGCCGC TTACCGGATA CCTGTCCGCC TTTCTCCCTT CGGGAAGCGT GGCGCTTTCT CATAGCTCAC GCTGTAGGTA TCTCAGTTCG GTGTAGGTCG TTCGCTCCAA GCTGGGCTGT GTGCACGAAC CCCCCGTTCA GCCCGACCGC TGCGCCTTAT CCGGTAACTA TCGTCTTGAG TCCAACCCGG TAAGACACGA CTTATCGCCA CTGGCAGCAG CCACTGGTAA CAGGATTAGC AGAGCGAGGT ATGTAGGCGG TGCTACAGAG TTCTTGAAGT GGTGGCCTAA CTACGGCTAC ACTAGAAGGA CAGTATTTGG TATCTGCGCT CTGCTGAAGC CAGTTACCTT CGGAAAAAGA GTTGGTAGCT CTTGATCCGG CAAACAAACC ACCGCTGGTA GCGGTGGTTT TTTTGTTTGC AAGCAGCAGA TTACGCGCAG AAAAAAAGGA TCTCAAGAAG ATCCTTTGAT CTTTTCTACG GGGTCTGACG CTCAGTGGAA CGAAAACTCA CGTTAAGGGA TTTTGGTCAT GAGATTATCA AAAAGGATCT TCACCTAGAT CCTTTTAAAT TAAAAATGAA GTTTTAAATC AATCTAAAGT ATATATGAGT AAACTTGGTC TGACAGTTAC CAATGCTTAA TCAGTGAGGC ACCTATCTCA GCGATCTGTC TATTTCGTTC ATCCATAGTT GCCTGACTCC CCGTCGTGTA GATAACTACG ATACGGGAGG GCTTACCATC TGGCCCCAGT GCTGCAATGA TACCGCGAGA CCCACGCTCA CCGGCTCCAG ATTTATCAGC AATAAACCAG CCAGCCGGAA GGGCCGAGCG CAGAAGTGGT CCTGCAACTT TATCCGCCTC CATCCAGTCT ATTAATTGTT GCCGGGAAGC TAGAGTAAGT AGTTCGCCAG TTAATAGTTT GCGCAACGTT GTTGCCATTG CTACAGGCAT CGTGGTGTCA CGCTCGTCGT TTGGTATGGC TTCATTCAGC TCCGGTTCCC AACGATCAAG GCGAGTTACA TGATCCCCCA TGTTGTGCAA AAAAGCGGTT AGCTCCTTCG GTCCTCCGAT CGTTGTCAGA AGTAAGTTGG CCGCAGTGTT ATCACTCATG GTTATGGCAG CACTGCATAA TTCTCTTACT GTCATGCCAT CCGTAAGATG CTTTTCTGTG ACTGGTGAGT ACTCAACCAA GTCATTCTGA GAATAGTGTA TGCGGCGACC GAGTTGCTCT TGCCCGGCGT CAATACGGGA TAATACCGCG CCACATAGCA GAACTTTAAA AGTGCTCATC ATTGGAAAAC GTTCTTCGGG GCGAAAACTC TCAAGGATCT TACCGCTGTT GAGATCCAGT TCGATGTAAC CCACTCGTGC ACCCAACTGA TCTTCAGCAT CTTTTACTTT CACCAGCGTT TCTGGGTGAG CAAAAACAGG AAGGCAAAAT GCCGCAAAAA AGGGAATAAG GGCGACACGG AAATGTTGAA TACTCATACT CTTCCTTTTT CAATATTATT GAAGCATTTA TCAGGGTTAT TGTCTCATGA GCGGATACAT ATTTGAATGT ATTTAGAAAA ATAAACAAAT AGGGGTTCCG CGCACATTTC CCCGAAAAGT GCCACCTGAC GTCTAAGAAA CCATTATTAT CATGACATTA ACCTATAAAA ATAGGCGTAT CACGAGGCAG AATTTCAGAT AAAAAAAATC CTTAGCTTTC GCTAAGGATG ATTTCTGGAA TTCGCGGCCG CATCTAGAG</pre></html>

Primers:

Forward: GCTTTCGCTAAGGATGATTTCT
  • Mp: 60C
Reverse: TCAGTGAGCGAGGAAGC
  • Mp: 60C

Sequencing primers for biobrick of XylR

<html><pre><font color=green>ATG</font>TTTACTA AACGTCACCG CATCACATTA CTGTTCAATG CCAATAAAGC CTATGACCGG CAGGTAGTAG AAGGCGTAGG GGAATATTTA CAGGCGTCAC AATCGGAATG GGATATTTTC ATTGAAGAAG ATTTCCGCGC CCGCATTGAT AAAATCAAGG ACTGGTTAGG AGATGGCGTC ATTGCCGACT TCGACGACAA ACAGATCGAG CAAGCGCTGG CTGATGTCGA CGTCCCCATT GTTGGGGTTG GCGGCTCGTA TCACCTTGCA GAAAGTTACC CACCCGTTCA TTACATTGCC ACCGATAACT ATGCGCTGGT TGAAAGCGCA TTTTTGCATT TAAAAGAGAA AGGCGTTAAC CGCTTTGCTT TTTATGGTCT TCCGGAATCA AGCGGCAAAC GTTGGGCCAC TGAGCGCGAA TATGCATTTC GTCAGCTTGT CGCCGAAGAA AAGTATCGCG GAGTGGTTTA TCAGGGGTTA GAAACCGCGC CAGAGAACTG GCAACACGCG CAAAATCGGC TGGCAGACTG GCTACAAACG CTACCACCGC AAACCGGGAT TATTGCCGTT ACTGACGCCC GAGCGCGGCA TATTCTGCAA GTATGTGAAC ATCTACATAT TCCCGTACCG GAAAAATTAT GCGTGATTGG CATCGATAAC GAAGAACTGA CCCGCTATCT GTCGCGTGTC GCCCTTTCTT CGGTCGCTCA GGGCGCGCGG CAAATGGGCT ATCAGGCGGC AAAACTGTTG CATCGATTAT TAGATAAAGA AGAAATGCCG CTACAGCGAA TTTTGGTCCC ACCAGTTCGC GTCATTGAAC GGCGCTCAAC AGATTATCGC TCGCTGACCG ATCCCGCCGT TATTCAGGCC ATGCATTACA TTCGTAATCA CGCCTGTAAA GGGATTAAAG TGGATCAGGT ACTGGATGCG GTCGGGATCT CGCGCTCCAA TCTTGAGAAG CGTTTTAAAG AAGAGGTGGG TGAAACCATC CATGCCATGA TTCATGCCGA GAAGCTGGAG AAAGCGCGCA GTCTGCTGAT TTCAACCACC TTGTCGATCA ATGAGATATC GCAAATGTGC GGTTATCCAT CGCTGCAATA TTTCTACTCT GTTTTTAAAA AAGCATATGA CACGACGCCA AAAGAGTATC GCGATGTAAA TAGCGAGGTC ATGTTG<font color=red>TAG</font></pre></html>

Primers:

Forward: ATGTTTACTAAACGTCACCGCATCA
  • Mp: 65C
Reverse: CTACAACATGACCTCGCTATTTACAT
  • Mp: 62C