IGEM:PennState/Labbook/GalenLynch/2007-6-11

From OpenWetWare
Jump to: navigation, search

June 11th, 2007: 9:30-1:00, 3:45-5:00

Note: Start codons are in green, stop codons are in read, translational terminators are in blue

XylR with promoter and rbs and terminator (right)

<html><pre>GCAACCAAAC GCCGTTCTTG ATTTTGATAA AAATTTTCTC AAAGCCGGTT ACGTATTACC GGTTTTGAGT TTTTGCATGA TTCAGCAGGA AAAGAACC<font color=green>AT G</font>TTTACTAAA CGTCACCGCA TCACATTACT GTTCAATGCC AATAAAGCCT ATGACCGGCA GGTAGTAGAA GGCGTAGGGG AATATTTACA GGCGTCACAA TCGGAATGGG ATATTTTCAT TGAAGAAGAT TTCCGCGCCC GCATTGATAA AATCAAGGAC TGGTTAGGAG ATGGCGTCAT TGCCGACTTC GACGACAAAC AGATCGAGCA AGCGCTGGCT GATGTCGACG TCCCCATTGT TGGGGTTGGC GGCTCGTATC ACCTTGCAGA AAGTTACCCA CCCGTTCATT ACATTGCCAC CGATAACTAT GCGCTGGTTG AAAGCGCATT TTTGCATTTA AAAGAGAAAG GCGTTAACCG CTTTGCTTTT TATGGTCTTC CGGAATCAAG CGGCAAACGT TGGGCCACTG AGCGCGAATA TGCATTTCGT CAGCTTGTCG CCGAAGAAAA GTATCGCGGA GTGGTTTATC AGGGGTTAGA AACCGCGCCA GAGAACTGGC AACACGCGCA AAATCGGCTG GCAGACTGGC TACAAACGCT ACCACCGCAA ACCGGGATTA TTGCCGTTAC TGACGCCCGA GCGCGGCATA TTCTGCAAGT ATGTGAACAT CTACATATTC CCGTACCGGA AAAATTATGC GTGATTGGCA TCGATAACGA AGAACTGACC CGCTATCTGT CGCGTGTCGC CCTTTCTTCG GTCGCTCAGG GCGCGCGGCA AATGGGCTAT CAGGCGGCAA AACTGTTGCA TCGATTATTA GATAAAGAAG AAATGCCGCT ACAGCGAATT TTGGTCCCAC CAGTTCGCGT CATTGAACGG CGCTCAACAG ATTATCGCTC GCTGACCGAT CCCGCCGTTA TTCAGGCCAT GCATTACATT CGTAATCACG CCTGTAAAGG GATTAAAGTG GATCAGGTAC TGGATGCGGT CGGGATCTCG CGCTCCAATC TTGAGAAGCG TTTTAAAGAA GAGGTGGGTG AAACCATCCA TGCCATGATT CATGCCGAGA AGCTGGAGAA AGCGCGCAGT CTGCTGATTT CAACCACCTT GTCGATCAAT GAGATATCGC AAATGTGCGG TTATCCATCG CTGCAATATT TCTACTCTGT TTTTAAAAAA GCATATGACA CGACGCCAAA AGAGTATCGC GATGTAAATA GCGAGGTCAT GTTG<font color = red>TAG</font>CGA TGATGAGAAT TGTCGGCGTC ACATCAGGTA ACGCTGCGTG GTTGTCGGAT GCGGCGTGAA CGCCTTATCC GACCTACCCG CCAGGCATGA TAAAACGCAC CAACAACGCT TCAGGCTCGT AGCTCAACTG CCTGAGACAA AGTAAAA<font color=blue>AGC CTTATCCGAC TGACAAGTCG GATAAGGCT</font>C AAGGAAATGC AAT</pre></html>

Primers:

ggaattcgcg gccgcttcta gag GCAACCAAAC GCCGTTCT (left side)
 Sequence for operations: ggaattcgcggccgcttctagagGCAACCAAACGCCGTTCT
  • TmC 63,81
ctgcagcggc cgctactagt a  ATTGCATTTC CTTGAGCCTT ATCC (right side)
 Sequence for operations: ctgcagcggccgctactagtaATTGCATTTCCTTGAGCCTTATCC
  • TmC 63,78

XylR with promoter and rbs (left)

<html><pre>ATTGCATTTC CTTG<font color=blue>AGCCTT ATCCGACTTG TCAGTCGGAT AAGGCT</font>TTTT ACTTTGTCTC AGGCAGTTGA GCTACGAGCC TGAAGCGTTG TTGGTGCGTT TTATCATGCC TGGCGGGTAG GTCGGATAAG GCGTTCACGC CGCATCCGAC AACCACGCAG CGTTACCTGA TGTGACGCCG ACAATTCTCA TCATCG<font color=red>CTA</font>C AACATGACCT CGCTATTTAC ATCGCGATAC TCTTTTGGCG TCGTGTCATA TGCTTTTTTA AAAACAGAGT AGAAATATTG CAGCGATGGA TAACCGCACA TTTGCGATAT CTCATTGATC GACAAGGTGG TTGAAATCAG CAGACTGCGC GCTTTCTCCA GCTTCTCGGC ATGAATCATG GCATGGATGG TTTCACCCAC CTCTTCTTTA AAACGCTTCT CAAGATTGGA GCGCGAGATC CCGACCGCAT CCAGTACCTG ATCCACTTTA ATCCCTTTAC AGGCGTGATT ACGAATGTAA TGCATGGCCT GAATAACGGC GGGATCGGTC AGCGAGCGAT AATCTGTTGA GCGCCGTTCA ATGACGCGAA CTGGTGGGAC CAAAATTCGC TGTAGCGGCA TTTCTTCTTT ATCTAATAAT CGATGCAACA GTTTTGCCGC CTGATAGCCC ATTTGCCGCG CGCCCTGAGC GACCGAAGAA AGGGCGACAC GCGACAGATA GCGGGTCAGT TCTTCGTTAT CGATGCCAAT CACGCATAAT TTTTCCGGTA CGGGAATATG TAGATGTTCA CATACTTGCA GAATATGCCG CGCTCGGGCG TCAGTAACGG CAATAATCCC GGTTTGCGGT GGTAGCGTTT GTAGCCAGTC TGCCAGCCGA TTTTGCGCGT GTTGCCAGTT CTCTGGCGCG GTTTCTAACC CCTGATAAAC CACTCCGCGA TACTTTTCTT CGGCGACAAG CTGACGAAAT GCATATTCGC GCTCAGTGGC CCAACGTTTG CCGCTTGATT CCGGAAGACC ATAAAAAGCA AAGCGGTTAA CGCCTTTCTC TTTTAAATGC AAAAATGCGC TTTCAACCAG CGCATAGTTA TCGGTGGCAA TGTAATGAAC GGGTGGGTAA CTTTCTGCAA GGTGATACGA GCCGCCAACC CCAACAATGG GGACGTCGAC ATCAGCCAGC GCTTGCTCGA TCTGTTTGTC GTCGAAGTCG GCAATGACGC CATCTCCTAA CCAGTCCTTG ATTTTATCAA TGCGGGCGCG GAAATCTTCT TCAATGAAAA TATCCCATTC CGATTGTGAC GCCTGTAAAT ATTCCCCTAC GCCTTCTACT ACCTGCCGGT CATAGGCTTT ATTGGCATTG AACAGTAATG TGATGCGGTG ACGTTTAGTA AA<font color<font color=green>CAT</font>GGTTC TTTTCCTGCT GAATCATGCA AAAACTCAAA ACCGGTAATA CGTAACCGGC TTTGAGAAAA TTTTTATCAA AATCAAGAAC GGCGTTTGGT TGC</pre></html>

Primers:

ggaattcgcg gccgcttcta gag ATTGCATTTC CTTGAGCCTT ATCC (right side)
 Sequence for operations: ggaattcgcggccgcttctagagATTGCATTTCCTTGAGCCTTATCC
  • TmC 63,79
ctgcagcggc cgctactagt a  GCAACCAAAC GCCGTTCT (left side)
 Sequence for operations: ctgcagcggccgctactagtaGCAACCAAACGCCGTTCT
  • TmC 63,80

XylR open reading frame (right)

<html><pre><font color=green>ATG</font>TTTACTA AACGTCACCG CATCACATTA CTGTTCAATG CCAATAAAGC CTATGACCGG CAGGTAGTAG AAGGCGTAGG GGAATATTTA CAGGCGTCAC AATCGGAATG GGATATTTTC ATTGAAGAAG ATTTCCGCGC CCGCATTGAT AAAATCAAGG ACTGGTTAGG AGATGGCGTC ATTGCCGACT TCGACGACAA ACAGATCGAG CAAGCGCTGG CTGATGTCGA CGTCCCCATT GTTGGGGTTG GCGGCTCGTA TCACCTTGCA GAAAGTTACC CACCCGTTCA TTACATTGCC ACCGATAACT ATGCGCTGGT TGAAAGCGCA TTTTTGCATT TAAAAGAGAA AGGCGTTAAC CGCTTTGCTT TTTATGGTCT TCCGGAATCA AGCGGCAAAC GTTGGGCCAC TGAGCGCGAA TATGCATTTC GTCAGCTTGT CGCCGAAGAA AAGTATCGCG GAGTGGTTTA TCAGGGGTTA GAAACCGCGC CAGAGAACTG GCAACACGCG CAAAATCGGC TGGCAGACTG GCTACAAACG CTACCACCGC AAACCGGGAT TATTGCCGTT ACTGACGCCC GAGCGCGGCA TATTCTGCAA GTATGTGAAC ATCTACATAT TCCCGTACCG GAAAAATTAT GCGTGATTGG CATCGATAAC GAAGAACTGA CCCGCTATCT GTCGCGTGTC GCCCTTTCTT CGGTCGCTCA GGGCGCGCGG CAAATGGGCT ATCAGGCGGC AAAACTGTTG CATCGATTAT TAGATAAAGA AGAAATGCCG CTACAGCGAA TTTTGGTCCC ACCAGTTCGC GTCATTGAAC GGCGCTCAAC AGATTATCGC TCGCTGACCG ATCCCGCCGT TATTCAGGCC ATGCATTACA TTCGTAATCA CGCCTGTAAA GGGATTAAAG TGGATCAGGT ACTGGATGCG GTCGGGATCT CGCGCTCCAA TCTTGAGAAG CGTTTTAAAG AAGAGGTGGG TGAAACCATC CATGCCATGA TTCATGCCGA GAAGCTGGAG AAAGCGCGCA GTCTGCTGAT TTCAACCACC TTGTCGATCA ATGAGATATC GCAAATGTGC GGTTATCCAT CGCTGCAATA TTTCTACTCT GTTTTTAAAA AAGCATATGA CACGACGCCA AAAGAGTATC GCGATGTAAA TAGCGAGGTC ATGTTG<font color=red>TAG</font></pre></html>

Primers:

 ggaattcgcg gccgcttcta gag ATGTTTACTA AACGTCACCG CATCA left side
  Sequence without spaces: ggaattcgcggccgcttctagagATGTTTACTAAACGTCACCGCATCA
  • TmC 65,79
 ctgcagcggc cgctactagt a CTACAACATG ACCTCGCTAT TTACAT right side
  Sequence wihout spaces: ctgcagcggccgctactagtaCTACAACATGACCTCGCTATTTACAT
  • TmC 62,77

XylR open reading frame (left)

<html><pre><font color=red>CTA</font>CAACATG ACCTCGCTAT TTACATCGCG ATACTCTTTT GGCGTCGTGT CATATGCTTT TTTAAAAACA GAGTAGAAAT ATTGCAGCGA TGGATAACCG CACATTTGCG ATATCTCATT GATCGACAAG GTGGTTGAAA TCAGCAGACT GCGCGCTTTC TCCAGCTTCT CGGCATGAAT CATGGCATGG ATGGTTTCAC CCACCTCTTC TTTAAAACGC TTCTCAAGAT TGGAGCGCGA GATCCCGACC GCATCCAGTA CCTGATCCAC TTTAATCCCT TTACAGGCGT GATTACGAAT GTAATGCATG GCCTGAATAA CGGCGGGATC GGTCAGCGAG CGATAATCTG TTGAGCGCCG TTCAATGACG CGAACTGGTG GGACCAAAAT TCGCTGTAGC GGCATTTCTT CTTTATCTAA TAATCGATGC AACAGTTTTG CCGCCTGATA GCCCATTTGC CGCGCGCCCT GAGCGACCGA AGAAAGGGCG ACACGCGACA GATAGCGGGT CAGTTCTTCG TTATCGATGC CAATCACGCA TAATTTTTCC GGTACGGGAA TATGTAGATG TTCACATACT TGCAGAATAT GCCGCGCTCG GGCGTCAGTA ACGGCAATAA TCCCGGTTTG CGGTGGTAGC GTTTGTAGCC AGTCTGCCAG CCGATTTTGC GCGTGTTGCC AGTTCTCTGG CGCGGTTTCT AACCCCTGAT AAACCACTCC GCGATACTTT TCTTCGGCGA CAAGCTGACG AAATGCATAT TCGCGCTCAG TGGCCCAACG TTTGCCGCTT GATTCCGGAA GACCATAAAA AGCAAAGCGG TTAACGCCTT TCTCTTTTAA ATGCAAAAAT GCGCTTTCAA CCAGCGCATA GTTATCGGTG GCAATGTAAT GAACGGGTGG GTAACTTTCT GCAAGGTGAT ACGAGCCGCC AACCCCAACA ATGGGGACGT CGACATCAGC CAGCGCTTGC TCGATCTGTT TGTCGTCGAA GTCGGCAATG ACGCCATCTC CTAACCAGTC CTTGATTTTA TCAATGCGGG CGCGGAAATC TTCTTCAATG AAAATATCCC ATTCCGATTG TGACGCCTGT AAATATTCCC CTACGCCTTC TACTACCTGC CGGTCATAGG CTTTATTGGC ATTGAACAGT AATGTGATGC GGTGACGTTT AGTAAA<font color=green>CAT</font></pre></html>


Primers:

 ggaattcgcggccgcttctagag CTACAACATG ACCTCGCTAT TTACAT left side
  Sequence for operations: ggaattcgcggccgcttctagagCTACAACATGACCTCGCTATTTACAT
  • TmC 62,78
 ctgcagcggccgctactagta ATGTTTACTA AACGTCACCG CATCA right side
  Sequence for operations: ctgcagcggccgctactagtaATGTTTACTAAACGTCACCGCATCA
  • TmC 65,78


Galen Lynch's Lab Notebook