IGEM:Peking University/2008/Notebook/Group 2/2008/05/17

From OpenWetWare
Jump to: navigation, search
PKU logo08 01.jpg Group 2 <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

Primer design

Primer 1
  • Primer name: F-Gal4-HindIII-Apal
  • Sequence(5'to3'):AAAAAGCTTGGGCCCTTTTAAGAGAGGACAGAGAAGCAAGCCTC
  • Tm:64.1°C
Primer 2
  • Primer name: R-Gal4-EcoRI-Xhol
  • Sequence(5'to3'):GGGGAATTCCTCGAGTGCGGGGTTTTTCAGTATCTACGATTCATT
  • Tm:64.0°C


PCR

TITLE: PCR-Budding Yeast Genome-Gal4-K.O.D 50ul
Volume (μL)
Template (Budding Yeast Genome) 1
dNTP 5
Enzyme 1
Buffer 5
MgSO4(For KOD) 2
F-Gal4-HindIII-ApaI 1
R-Gal4-EcoRI-Xhol 1
ddH2O 34
conditions
Temperature(&&&) Time Length(0:00:00)
94°C 07:00
94°C 00:30 30 cycles
59°C 00:30 30 cycles
55°C 00:30 30 cycles
72°C 03:00 30 cycles
72°C 07:00
4°C Hold