IGEM:Melbourne/2008/BCRiboswitch/Existing Riboswitches/Sequence

From OpenWetWare
Jump to: navigation, search

Riboswitch Mainpage

Return to Existing Riboswitches


1

BBa_J01010

aacuagaaucaccucuuggauuuggguauuaaagaggaga


BBa_J01060

ucccuaucagugauagagauugacaucccuaucagugauagagauacugagcacuacuagagaacuagaaucaccucuuggauuuggguauuaaagaggaga


BBa_J01008

acccaaauccaggaggugaaucuaguaggugguuaaugaaaauuaacuuacuuacuagaaauaucucuaaaaagccagauuauuaauccggcuu

2

BBa_J01080

aacuagaaucaccucuugcuuuuggguaagaaagaggaga


BBa_J01122

ucccuaucagugauagagauugacaucccuaucagugauagagauacugagcacuacuagagaacuagaaucaccucuugcuuuuggguaagaaagaggagauacuag auggcuuccuccgaagacguuaucaaagaguucaugcguuucaaaguucguauggaagguuccguuaacggucacgaguucgaaaucgaagguga aggugaaggucguccguacgaagguacccagaccgcuaaacugaaaguuaccaaaggugguccgcugccguucgcuugggacauccuguccccgc aguuccaguacgguuccaaagcuuacguuaaacacccggcugacaucccggacuaccugaaacuguccuucccggaagguuucaaaugggaacgu guuaugaacuucgaagacggugguguuguuaccguuacccaggacuccucccugcaagacggugaguucaucuacaaaguuaaacugcgugguac caacuucccguccgacgguccgguuaugcagaaaaaaaccauggguugggaagcuuccaccgaacguauguacccggaagacggugcucugaaag gugaaaucaaaaugcgucugaaacugaaagacgguggucacuacgacgcugaaguuaaaaccaccuacauggcuaaaaaaccgguucagcugccg ggugcuuacaaaaccgacaucaaacuggacaucaccucccacaacgaagacuacaccaucguugaacaguacgaacgugcugaaggucgucacuc caccggugcuuaauaacgcugauagugcuaguguagaucgcuacuagagccaggcaucaaauaaaacgaaaggcucagucgaaagacugggccuu ucguuuuaucuguuguuugucggugaacgcucucuacuagagucacacuggcucaccuucgggugggccuuucugcguuuaua


BBa_J01086

acccaaaagcaggaggugaaucuaguaggugguuaaugaaaauuaacuuacuuacuagaaauaucucuaaaaagccagauuauuaauccggcuu


BBa_J23008

acccaaaagcaagaggugauucuaguuggugguuaaugaaaauuaacuuacuuacuagaaauaucucuaaaaagccagauuauuaauccggcuu

(94bp)