IGEM:MIT/2006/Notebook/2006-8-9
From OpenWetWare
Jump to navigationJump to search
Smells!!!! : )
- the banana and wintergreen generating devices are assembled and WORKING!!! YAY!!! what an exciting day :-D
Our New Biobricks!
Let's give a big warm welcome to:
- J45100 (Prom40+RBS30+BSMT+Term15) [A/T]
- J45120 (Prom40+RBS32+BSMT+Term15) [A/T]
- J45170 (PromOS+RBS32+BSMT+Term15) [A/T]
- J45200 (Prom40+RBS30+ATF1+Term15) [A/T]
- J45220 (Prom40+RBS32+ATF1+Term15) [A/T]
We will also be updating the registry with all of our intermediate parts as well. Here's a quick outline of our planned number scheme:
- J45098 (BSMT+Term15) [A/K]
- J45099 (RBS30+BSMT+Term15) [A/T]
- J45119 (RBS32+BSMT+Term15) [A/T]
- J45199 (RBS30+ATF1+Term15) [A or A/K]
- J45219 (RBS32+ATF1+Term15) [A or A/K]
And, there are always our coding regions...
- J45001 (SAMT) [A]
- J45002 (BAMT) [A]
- J45004 (BSMT) [A]
- J45008 (BAT2 with SpeI site) [A/T]
- J45014 (ATF1 with mutation to eliminate EcoRI, but still has a random mutation) [A]
J453xx, 4xx etc will be for the next devices we build.
To do
- check 42 sample sequencing order in VectorNTI
- remember ATF1 parts prob have 2 RBS
- SMELL LCs (and miniprep plus sequence promising ones)
- remember that the ATF1 assembly is a mutant version [J45014]
- ATF1 mutagenesis (??)
- make LCs of pUCP22 cell colonies (LB Amp)
- make LCs of overnight transformants (all in LB A/T, some with SA or IA)
BAT2 mutation primers to eliminate SpeI
Primer pair 3
*
Forward: 5' CGGGCAAGAAGGAACTGGTTACTGCTCCACTAG 3'
Reverse: 5' CTAGTGGAGCAGTAACCAGTTCCTTCTTGCCCG 3'
*
GC content: 54.55% Location: 32-64
Melting temp: 80.6°C Mismatched bases: 1
Length: 33 bp Mutation: Substitution
5' flanking region: 16 bp Forward primer MW: 10187.73 Da
3' flanking region: 16 bp Reverse primer MW: 10080.66 Da