IGEM:MIT/2005/Primers

From OpenWetWare
Jump to: navigation, search

The melting temperatures were calculated mostly by the following site: Oligonucleotide Primer Check

  • scFv (pCT-4-4-20, pCT302 S101A, pCT-4M5.3 anti-fluorescein plasmids)
FWD: 5' CATCAT GAATTC GCGGCCGC T TCTAGA GACGTCGTTATGACTCAAACACC 3' T_m,i=71.8 T_m,f=88.5
         rand   EcoRI   NotI      XbaI       Primer
REV: 5' GCTCAT  ACTAGT TTATTA CTTATCATCATCATCCTTATAATC GGAGACGGTGACTGAGGTTCC 3' T_m,i=74.7 T_m,f=87.1
         rand    SpeI   Stop          FLAG Tag                 Primer
  • FecA
fecA-Fwd  5’CATCAT  GAATTC  GCGGCCGC  TCTAGA TGACGCCGTTACGCGTTTTTCG 3’ T_m,i=73.2 T_m,f=89.6
             rand    EcoRI    NotI    XbaI     primer
fecA-Rev  5’GCCATA  ACTAGT  TTATTA  TCAGAACTTCAACGACCCCT 3’ T_m,i=68.2 T_m,f=79.9
             rand    SpeI     stop    primer
Middle Fwd- 5'GGACGGCAGCGGACTGCAAGTAAAACCGCTGGGAAATAAC 3' T_m=84.7
Middle Rev- 5’GTTATTTCCCAGCGGTTTTACTTGCAGTCCGCTGCCGTCC 3' T_m=84.7
fecA Promoter Fwd- 5’CATCAT  GAATTC  GCGGCCGC T TCTAGA  TGGATAAACATTTCACCACTG 3' T_m,i=65.0 T_m,f=86.2
                     rand    EcoRI    NotI      XbaI     primer
fecA Promoter Rev- 5'GCCATA  CTGCAG  CGGCCGC  T ACTAGT  CACAAGTCGATACTCAGCTTG 3' T_m,i=68.9 T_m,f=89.8
                     rand    PstI     NotI      SpeI     primer
  • FecR
fecR-Fwd 5' CATCAT  GAATTC  GCGGCCGC TCTAGA tgaatcctttgttaaccgattccc 3'T_m 66 
             rand   EcoRI     NotI     XbaI   primer
fecR-Rev 5' GCCATA  ACTAGT  TTATTA ttacagtggtgaaatgtttatccag 3' T_m 68
             rand   SpeI     stop   primer

Middle Fwd 5'gtgaaagcctacagttcagcgcctcag3'  T_m 84
Middle Rev 5'ctgaggcgctgaactgtaggctttcac3'  T_m 84
  • FecI
fecI-Fwd 5'CATCAT GAATTC GCGGCCGC T TCTAGA tgtctgaccgcgccactacc3' T_m 68
           rand   EcoRI    NotI     XbaI  primer
fecI-Rev 5'GCCATA CTGCAG CGGCCGC T ACTAGT A TTATTA tcataacccatactccagacggaa3' T_m 70
            rand  PstI    NotI      SpeI     stop  primer
  • MalE (updated/fixed)
fwd: 5' CCGTTA  GAATTC GCGGCCGC T TCTAGA atgaaaataaaaacaggtgcacgc3' T_m,i=68.8 T_m,f=85.5
         junk    EcoRI    NotI     XbaI       Primer
*
rev: 5' ACTGAG  CTGCAG GCGGCCGC T ACTAGT TTATTA  TTACTTGGTGATACGAGTCTGC 3' T_m,i=69.5 T_m,f=89.4
         junk    PstI    NotI      SpeI   Stop        Primer
  • PhoA
fwd: 5'     CATGAG  GAATTC GCGGCCGC T TCTAGA ATGAAACAGAGCACCATTGCG 3' T_m,i=68.9 T_m,f=88.8
             junk    EcoRI    NotI     XbaI       Primer
rev: 5'     AAGCTA  CTGCAG GCGGCCGC T ACTAGT TTATTA TTATTTCAGGCCCAGCGCC 3' T_m,i=69.7 T_m,f=89.8
             junk    PstI    NotI      SpeI   Stop        Primer
Middle(1)
 fwd: 5' caccgcggaactgcaagatgcgaccccggcg 3' T_m=88.8
                        *
 rev: 5' CGCCGGGGTCGCATCTTGCAGTTCCGCGGTG 3' T_m=88.8
                        * 
Middle(2)
 fwd: 5' aggcttttttctgcaagtggaaggcgcgagc 3' T_m=82.2
                        *
 rev: 5' GCTCGCGCCTTCCACTTGCAGAAAAAAGCCT 3' T_m=82.2
                        *