IGEM:IMPERIAL/2009/Encapsulation/Parts/Module3/Sequences

From OpenWetWare
Jump to: navigation, search

Details of thermoinducible system

cI repressor

Uploaded cI857 sequence

Genbank Accession No: E00770

Patent: JP 1986074585-A 8 16-APR-1986

cI857 sequence


Harvard's characterised clts part

BBa_K098997

cI857 harvard part sequence

By blasting with cI857 sequence online

Identities = 711/714 (99%)
nucleotides: 83-796

By blasting with pGW7

100% identity (since gene was taken from pGW7)
4148-4861 (supposed clts gene according to pGW7 plasmid)


clts from pGW7

The gene and plasmid which Harvard took from

https://www.lablife.org/ct?f=v&a=showvecinfo&vectorid=5079 the clts gene given as from 4148 to 4861 (same as the part Harvard characterised)

The order of the major features in the plasmid is: EcoRI - partial O - partial cro - lambda R promoter - lambda M promoter - cIts - rexA - rexB - lambda L promoter - HpaI / N - BamHI - SphI - SalI - pMB1 ori – ampR

By blasting with uploaded cI857 sequence

Identities = 870/873 (99%)
4045 to 4917 of pGW7 (27-899 of cI857 gene)



Other plasmids by blasting using Harvard's part

  • Escherichia coli plasmid pGBG1

GenBank: AJ277653.1
Simple construct containing only TetA gene and cI gene

  • pTR262

GenBank: X00166.1

  • Other cloning vectors

pND707/706, pCL476/478, pPL450-452, pBT, pMM200


Other plasmids from papers

  • pAW12
  • pAWJ


lambda promoter

Registry part

BBa_R0051

Essentially the same as other lambda Pr promoters but stops after OR2.

Sequence: (-49)TAACACCGTG CGTGTTGACT ATTTTACCTC TGGCGGTGAT AATGGTTGC (-1)


From pAW12

Allows normal growing at up till 30 degrees

Sequence: TATCACCGCAAGGGATAAATATCTAACACCGTG CGTGTTGACT ATTTTACCTC TGGCGGTGAT AATGGTTGC


From pAWJ

Only difference from pAW12 is that it contains a mutation at 41C.
Supposedly allows normal growing at 36 degrees, but promoter strength is weakened.

Sequence: TATCACCGCAAGGGATAAATATCTAACACCGCG CGTGTTGACT ATTTTACCTC TGGCGGTGAT AATGGTTGC

BLASTED with LacI binding site from Registry (R0010)
No significant similarity found, therefore presumably there is no crosstalk.


From pGW7

Contains both lambda R and lambda L.

Lambda R sequence detected by blasting with pAWJ. The sequence is the same (100% identity).


List of plasmids

List of plasmids