IGEM:IMPERIAL/2007/Projects/Cell by date/Implementation/List of Required Parts

From OpenWetWare
Jump to: navigation, search

DNA Constructs

pTet GFP


  • Registry part: BBa_I13522
  • Comments: Untagged GFP behind a constitutive promoter.
  • DNA Available in the registry



T7 basic construct.bmp

  • Registry part: BBa_J34814
  • T7 promoter sequence: gaatttaatacgactcactatagggaga
  • Comments: T7 Promoter to be used qith t7 polymerase BBa_J34811
  • DNA still in planning
  • pT7 sequence from Ambion:

T7 promoter.jpg

pBad GFP


  • Registry part: BBa_J5528
  • Comments: Similar to part J5527 where mRFP is replaced with GFP
  • DNA Available in the registry
  • Allows tight control in E. coli

Generic Components

  • RBS (Elowitz)


Short description: This is the most efficient RBS in the registry, and sets the 1.0 efficiency standard. It is based on the Elowitz repressilator.

  • Double terminator (B0010-B0012)


Short description: Double terminator consisting of BBa_B0010 and BBa_B0012. This is the most commonly used terminator. It seems to be reliable.
-forward_efficiency: 0.984
-reverse_efficiency: 0.295

Other Materials

  • DsRed-Express

  • T7 RNApol


Short description: To be used with specal tRNA loading glutamate instead of stop codon (Part BBa_J34812).

  • tRNA loading Glutamate on stop codon TTT
