IGEM:IMPERIAL/2006/project/primers/Cre Lox

Primer 1

• Primer 1 is the same as the sense streand and consists of
  • Restriction Sites – Lox Site – Stop Codon – First 20 bases of part B0021

GAATTCGCGGCCGCTTCTAGAGCGATAACTTGGTATAGCATACATTATACGAACGGTATGAAAATAATAAAAAAGCGG

Primer 2

• We need both the sense strand and the anti-sense strand for this primer
  • 31bp into part B0021 (long due to a run of T and A)
  • 22bp into part I13521

Sense Strand :

CGGATTAATAATCTGGCTTTTTATATTCTCTTATAAACGCAGAAAGGCCCACC

Antisense Strand:

GGTGGGCCTTTCTGCGTTTATAAGAGAATATAAAAAGCCAGATTATTAATCCG

Primer 3

• Primer 3 contans a section complementary to the sense strand of the construct and a Lox site and some restriction sites. It was made by copying the end of the desired sense strand and making it complementary and reversing it.

CTGCAGCGGCCGCTACTAGTAATAACTTCGTATAATGTATCGTATACGAACGGTAACTCCCTATCAGTGATAGAGATTGACATCC

For further information on incorporation [here]