IGEM:IMPERIAL/2006/project/parts/jonny

From OpenWetWare
Jump to: navigation, search

Jonny gave us a sequence without telling us what it is

I am 100% sure it is the correct sequence for J37019 because...

Sequencce

TTGAGTTTTAGAAATAACAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTA
TCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGAT
GATTTCTGGAATTCGCGGCCGCTTCTAGAGACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGA
ATAAATACTAGAGAAAGAGGAGAAATACTAGATGAAAAACATAAATGCCGACGACACATACAGAATAATTAATAAAATTA
AAGCTTGTAGAAGCAATAATGATATTAATCAATGCTTATCTGATATGACTAAAATGGTACATTGTGAATATTATTTACTC
GCGATCATTTATCCTCATTCTATGGTTAAATCTGATATTTCAATCCTAGATAATTACCCTAAAAAATGGAGGCAATATTA
TGATGACGCTAATTTAATAAAATATGATCCTATAGTAGATTATTCTAACTCCAATCATTCACCAATTAATTGGAATATAT
TTGAAAACAATGCTGTAAATAAAAAATCTCCAAATGTAATTAAAGAAGCGAAAACATCAGGTCTTATCACTGGGTTTAGT
TTCCCTATTCATACGGCTAACAATGGCTTCGGAATGCTTAGTTTTGCACATTCAGAAAAAGACAACTATATAGATAGTTT
ATTTTTACATGCGTGTATGAACATACCATTAATTGTTCCTTCTCTAGNTGATAATTATCGNAAAANTTACATTTNGCAAA
TTATAANATCCAACAACGATTTAACCAAAAGAGAAAAAGAAAGGTTTAGGCGTGGGGCATGCGAAGGAAAAAAGCTCTTG
GGATNTTTCCAAAAATNTTNGGNTGCAGNGNGCGTCCTGTCCCCTTTCCNTTTGANCNANGNCGCAAATGNAACTCCANT
CCAACNANCNGCTGNCNAGGTNTTCTTAAGCCANTTTTANCGGNNCCANTNGATTGCCCNNCCTTTNAAANTNNANANCC
NGGATNGGGGCTTGGGGGGGGNTCCCTTCCNNNGNCAANGGGGGGGNNNTCCCGGTGGG

Alignment with J37015

I can say with absolute certianty that this sequences contains the RBS B0034 followed by LuxR It may also contain the promoter but we cannot be sure

CLUSTAL W (1.83) multiple sequence alignment
test            TTGAGTTTTAGAAATAACAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGA 60
J37015          ------------------------------------------------------------
                                                                           

test            CGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCA 120
J37015          ------------------------------------------------------------
                                                                            

test            GAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTGGAATTCGCGGCC 180
J37015          ------------------------------------------------------------
                                                                           

test            GCTTCTAGAGACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGA 240
J37015          -----------TCCCTATCAGTGATAGAGATTGACATCCCTATCAGTGATAGAGATACTG 49
                            *  **  *  *     * **         *   **     * *  *  

test            ATAAATACTAGAGAAAGAGGAGAAATACTAGATGAAAAACATAAATGCCGACGACACATA 300
J37015          AGCACTACTAGAGAAAGAGGAGAAATACTAGATGAAAAACATAAATGCCGACGACACATA 109
                *  * *******************************************************

test            CAGAATAATTAATAAAATTAAAGCTTGTAGAAGCAATAATGATATTAATCAATGCTTATC 360 
J37015          CAGAATAATTAATAAAATTAAAGCTTGTAGAAGCAATAATGATATTAATCAATGCTTATC 169
                ************************************************************

test            TGATATGACTAAAATGGTACATTGTGAATATTATTTACTCGCGATCATTTATCCTCATTC 420
J37015          TGATATGACTAAAATGGTACATTGTGAATATTATTTACTCGCGATCATTTATCCTCATTC 229
                ************************************************************

test            TATGGTTAAATCTGATATTTCAATCCTAGATAATTACCCTAAAAAATGGAGGCAATATTA 480
J37015          TATGGTTAAATCTGATATTTCAATCCTAGATAATTACCCTAAAAAATGGAGGCAATATTA 289
                ************************************************************   

test            TGATGACGCTAATTTAATAAAATATGATCCTATAGTAGATTATTCTAACTCCAATCATTC 540
J37015          TGATGACGCTAATTTAATAAAATATGATCCTATAGTAGATTATTCTAACTCCAATCATTC 349
                ************************************************************

test            ACCAATTAATTGGAATATATTTGAAAACAATGCTGTAAATAAAAAATCTCCAAATGTAAT 600
J37015          ACCAATTAATTGGAATATATTTGAAAACAATGCTGTAAATAAAAAATCTCCAAATGTAAT 409
                ************************************************************ 

test            TAAAGAAGCGAAAACATCAGGTCTTATCACTGGGTTTAGTTTCCCTATTCATACGGCTAA 660
J37015          TAAAGAAGCGAAAACATCAGGTCTTATCACTGGGTTTAGTTTCCCTATTCATACGGCTAA 469
                ************************************************************ 

test            CAATGGCTTCGGAATGCTTAGTTTTGCACATTCAGAAAAAGACAACTATATAGATAGTTT 720
J37015          CAATGGCTTCGGAATGCTTAGTTTTGCACATTCAGAAAAAGACAACTATATAGATAGTTT 529
                ************************************************************

test            ATTTTTACATGCGTGTATGAACATACCATTAATTGTTCCTTCTCTAGTGATAATTATC-- 778
J37015          ATTTTTACATGCGTGTATGAACATACCATTAATTGTTCCTTCTCTAGTTGATAATTATCG 589
                ************************************************    * *     

test            GAAAATTACATTTGCAAATTATAAATCCAACAACGATTTAACCAAAAGAGAAAAAGAAAG 838
J37015          AAAAATAAATATAGCAAATAATAAATCAAACAACGATTTAACCAAAAGAGAAAAAGAATG 649
                 ***** *   * ****** ******* ****************************** *

test            GTTTAGGCGTGGGGCATGCGAAGGAAAAAAGCTCTTGGGATTTTCCAAAAATTTGGTGCA 898
J37015          TTTAGCGTGGGCATGCGAAGGAAAAAGCTCTTGGGATATTTCAAAAATATTAGGTTGCAG 709
                 **   * * *        * *  **              *     * *           

test            GGGCGTCCTGTCCCCTTTCCTTTGACAGCGCAAATGAACTCCATCCAACACGCTGCAGGT 958
J37015          TGAGCGTACTGTCACTTTCCATTTAACCAATGCGCAAATGAAACTCAATACAACAAACCG 769
                 *          * ****** ** *           **    *  *** **     *   

test            TTCTTAAGCCATTTTACGGCCATGATTGCCCCCTTTAAATAACCGGATGGGGCTTGGGGG 1018
J37015          CTGCCAAAGTATTTCTAAAGCAATTTTAACAGGAGCAATTGATTGCCCATACTTTAAAAA 829
                 *   **   ****      **   **  *      ** * *  *        **     

test            GGGTCCCTTCCGCAAGGGGGGGTCCCGGTGGG---------------------------- 1050
J37015          TTAATAACACTGATAGTGCTAGTGTAGATCACTACTAGAGCCAGGCATCAAATAAAACGA 889
                         * *  ** *   **   * *                               

test            ------------------------------------------------------------
J37015          AAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTC 949
                                                                            

test            ------------------------------------------------------------
J37015          TACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATATACTAGAGACC 1009
                                                                            

test            ------------------------------------------------------------
J37015          TGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGAATAAATACTAGAG 1069
                                                                           

test            ------------------------------------------------------------
J37015          AAAGAGGAGAAATACTAGATGACTATAATGATAAAAAAATCGGATTTTTTGGCAATTCCA 1129
                                                                           

test            ------------------------------------------------------------
J37015          TCGGAGGAGTATAAAGGTATTCTAAGTCTTCGTTATCAAGTGTTTAAGCAAAGACTTGAG 1189
                                                                            

test            ------------------------------------------------------------
J37015          TGGGACTTAGTTGTAGAAAATAACCTTGAATCAGATGAGTATGATAACTCAAATGCAGAA 1249
                                                                            

test            ------------------------------------------------------------
J37015          TATATTTATGCTTGTGATGATACTGAAAATGTAAGTGGATGCTGGCGTTTATTACCTACA 1309
                                                                              

test            ------------------------------------------------------------
J37015          ACAGGTGATTATATGCTGAAAAGTGTTTTTCCTGAATTGCTTGGTCAACAGAGTGCTCCC 1369
                                                                            

test            ------------------------------------------------------------
J37015          AAAGATCCTAATATAGTCGAATTAAGTCGTTTTGCTGTAGGTAAAAATAGCTCAAAGATA 1429
                                                                            

test            ------------------------------------------------------------
J37015          AATAACTCTGCTAGTGAAATTACAATGAAACTATTTGAAGCTATATATAAACACGCTGTT 1489
                                                                            

test            ------------------------------------------------------------
J37015          AGTCAAGGTATTACAGAATATGTAACAGTAACATCAACAGCAATAGAGCGATTTTTAAAG 1549
                                                                            

test            ------------------------------------------------------------
J37015          CGTATTAAAGTTCCTTGTCATCGTATTGGAGACAAAGAAATTCATGTATTAGGTGATACT 1609
                                                                             

test            ------------------------------------------------------------
J37015          AAATCGGTTGTATTGTCTATGCCTATTAATGAACAGTTTAAAAAAGCAGTCTTAAATGCT 1669
                                                                            

test            ------------------------------------------------------------
J37015          GCAAACGACGAAAACTACGCTTTAGTAGCTTAATAACTCTGATAGTGCTAGTGTAGATCT 1729
                                                                             

test            ------------------------------------------------------------
J37015          CTACTAGAGAAAGAGGAGAAATACTAGATGCGTAAAGGAGAAGAACTTTTCACTGGAGTT 1789
                                                                            

test            ------------------------------------------------------------
J37015          GTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGA 1849
                                                                            

test            ------------------------------------------------------------
J37015          GAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGA 1909
                                                                            

test            ------------------------------------------------------------
J37015          AAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTT 1969
                                                                            

test            ------------------------------------------------------------
J37015          GCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGT 2029
                                                                            

test            ------------------------------------------------------------
J37015          TATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAA 2089
                                                                            

test            ------------------------------------------------------------
J37015          GTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAA 2149
                                                                             

test            ------------------------------------------------------------
J37015          GAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATAC 2209
                                                                            

test            ------------------------------------------------------------
J37015          ATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATT 2269
                                                                            

test            ------------------------------------------------------------
J37015          GAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGC 2329
                                                                             

test            ------------------------------------------------------------
J37015          CCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCC 2389
                                                                             

test            ------------------------------------------------------------
J37015          AACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACAT 2449
                                                                            

test            ------------------------------------------------------------
J37015          GGCATGGATGAACTATACAAATAATAATACTAGAGCCAGGCATCAAATAAAACGAAAGGC 2509
                                                                             

test            ------------------------------------------------------------
J37015          TCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTA 2569
                                                                             
 
test            --------------------------------------------
J37015          GAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATA 2613

alignment with J37019 + restriction sites

This sequence reads restriction sites RBS Luxr so it is J37019

test                            TTGAGTTTTAGAAATAACAATAGGGGTTCCGCGCACATTTCCCCGAAAAG 50
restrictionsitesplusJ37019      --------------------------------------------------
                                                                                  

test                            TGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAA 100
restrictionsitesplusJ37019      --------------------------------------------------
                                                                                 

test                            AATAGGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTT 150
restrictionsitesplusJ37019      ---------------------------------AAAAAATCCTTAGCTTT 17
                                                                 *****************

test                            CGCTAAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGAGACCTGTAGGA 200
restrictionsitesplusJ37019      CGCTAAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGAGACCTGTAGGA 67
                                **************************************************

test                            TCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGAATAAATACTA 250
restrictionsitesplusJ37019      TCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGAATAAATACTA 117
                                ************************************************** 

test                            GAGAAAGAGGAGAAATACTAGATGAAAAACATAAATGCCGACGACACATA 300
restrictionsitesplusJ37019      GAGAAAGAGGAGAAATACTAGATGAAAAACATAAATGCCGACGACACATA 167
                                ************************************************** 

test                            CAGAATAATTAATAAAATTAAAGCTTGTAGAAGCAATAATGATATTAATC 350
restrictionsitesplusJ37019      CAGAATAATTAATAAAATTAAAGCTTGTAGAAGCAATAATGATATTAATC 217
                                **************************************************

test                            AATGCTTATCTGATATGACTAAAATGGTACATTGTGAATATTATTTACTC 400
restrictionsitesplusJ37019      AATGCTTATCTGATATGACTAAAATGGTACATTGTGAATATTATTTACTC 267
                                **************************************************
 
test                            GCGATCATTTATCCTCATTCTATGGTTAAATCTGATATTTCAATCCTAGA 450
restrictionsitesplusJ37019      GCGATCATTTATCCTCATTCTATGGTTAAATCTGATATTTCAATCCTAGA 317
                                ************************************************** 

test                            TAATTACCCTAAAAAATGGAGGCAATATTATGATGACGCTAATTTAATAA 500
restrictionsitesplusJ37019      TAATTACCCTAAAAAATGGAGGCAATATTATGATGACGCTAATTTAATAA 367
                                **************************************************

test                            AATATGATCCTATAGTAGATTATTCTAACTCCAATCATTCACCAATTAAT 550
restrictionsitesplusJ37019      AATATGATCCTATAGTAGATTATTCTAACTCCAATCATTCACCAATTAAT 417
                                **************************************************

test                            TGGAATATATTTGAAAACAATGCTGTAAATAAAAAATCTCCAAATGTAAT 600
restrictionsitesplusJ37019      TGGAATATATTTGAAAACAATGCTGTAAATAAAAAATCTCCAAATGTAAT 467
                                ************************************************** 

test                            TAAAGAAGCGAAAACATCAGGTCTTATCACTGGGTTTAGTTTCCCTATTC 650
restrictionsitesplusJ37019      TAAAGAAGCGAAAACATCAGGTCTTATCACTGGGTTTAGTTTCCCTATTC 517
                                ************************************************** 

test                            ATACGGCTAACAATGGCTTCGGAATGCTTAGTTTTGCACATTCAGAAAAA 700
restrictionsitesplusJ37019      ATACGGCTAACAATGGCTTCGGAATGCTTAGTTTTGCACATTCAGAAAAA 567
                                **************************************************

test                            GACAACTATATAGATAGTTTATTTTTACATGCGTGTATGAACATACCATT 750
restrictionsitesplusJ37019      GACAACTATATAGATAGTTTATTTTTACATGCGTGTATGAACATACCATT 617
                                ************************************************** 

test                            AATTGTTCCTTCTCTAGTGATAATTATC--GAAAATTACATTTGCAAATT 798
restrictionsitesplusJ37019      AATTGTTCCTTCTCTAGTTGATAATTATCGAAAAATAAATATAGCAAATA 667
                                ******************    * *      ***** *   * ****** 

test                            ATAAATCCAACAACGATTTAACCAAAAGAGAAAAAGAAAGGTTTAGGCGT 848
restrictionsitesplusJ37019      ATAAATCAAACAACGATTTAACCAAAAGAGAAAAAGAATGTTTAGCGTGG 717
                                ******* ****************************** * **   * * 

test                            GGGGCATGCGAAGGAAAAAAGCTCTTGGGATTTTCCAAAAATTTGGTGCA 898
restrictionsitesplusJ37019      GCATGCGAAGGAAAAAGCTCTTGGGATATTTCAAAAATATTAGGTTGCAG 767
                                *        * *  **              *     * *             

test                            GGGCGTCCTGTCCCCTTTCCTTTGACAGCGCAAATGAACTCCATCCAACA 948
restrictionsitesplusJ37019      TGAGCGTACTGTCACTTTCCATTTAACCAATGCGCAAATGAAACTCAATA 817
                                 *          * ****** ** *           **    *  *** *

test                            CGCTGCAGGTTTCTTAAGCCATTTTACGGCCATGATTGCCCCCTTTAAAT 998
restrictionsitesplusJ37019      CAACAAACCGCTGCCAAAGTATTTCTAAAGCAATTTTAACAGGAGCAATT 867
                                *     *    *   **   ****      **   **  *      ** *

test                            AACCGGATGGGGCTTGGGGGGGGTCCCTTCCGCAAGGGGGGGTCCCGGTG 1048
restrictionsitesplusJ37019      GATTGCCCATACTTTAAAAATTAATAACACTGATAGTGCTAGTGTAGATC 917
                                 *  *        **              * *  ** *   **   * * 

test                            GG 1050
restrictionsitesplusJ37019      AC 919