IGEM:Harvard/2008/Lab Notebooks/DailyBook/Week5/Chemical and Light

From OpenWetWare
Jump to: navigation, search

Contents

Testing Thermoinducible Lac System

Restreaked Plates of P92-3 in S1 7/21

Restreaked P93 (1:3), P92a, and P93b--all successfully transformed in S1--to detect YFP at 30 and 40 degrees.

Results 7/22

S1 P93 (1:3), P92a, and P93b plates grown at 30 and 40 degrees failed to demonstrate any difference in YFP expression. Both expressed very low, if any, YFP.

Thermoinducible Test 7/24

' ' ' Time ' ' ' ' ' ' ' ' ' ' ' '
0 hrs 2 hrs 4 hrs 6 hrs
Strain Replicate Before Splitting 30 30 + 1mM IPTG 40 42 30 30 + 1mM IPTG 40 42 30 30 + 1mM IPTG 40 42* DID NOT SHAKE
LB N/A Dilution N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A
OD 0 0 0 0 0 0 0 0 0 0 0 0 0
YFP 36.78 40.72 40.72 40.72 40.72 41.32 41.32 41.32 41.32 45.4 45.4 45.4 45.4
P84 A Dilution N/A 1 in 4 1 in 4 1 in 4.5 1 in 4.5 1 in 5 1 in 5 1 in 5.5 1 in 5.5 1 in 6 1 in 5.5 1 in 6.5 1 in 5.5
OD 0.269 0.229 0.218 0.216 0.214 0.241 0.224 0.227 0.219 0.243 0.234 0.243 0.224
YFP 291.95 242.89 226.53 216.85 211.21 226.95 222.07 196.83 196.3 250.22 238.06 224.98 215.35
YFP/OD 1085.315985 1060.655022 1039.12844 1003.935185 986.9626168 941.7012448 991.3839286 867.092511 896.347032 1029.711934 1017.350427 925.8436214 961.3839286
B Dilution N/A 1 in 4 1 in 4 1 in 4.5 1 in 4.5 1 in 5 1 in 5 1 in 5.5 1 in 5.5 1 in 6 1 in 5.5 1 in 6.5 1 in 5.5
OD 0.269 0.221 0.218 0.203 0.208 0.231 0.228 0.221 0.228 0.233 0.23 0.228 0.268
YFP 291.95 225.35 229.19 208.3 199.34 215.49 208.55 195.39 192.62 233.83 233.99 215.07 241.39
YFP/OD 1085.315985 1019.683258 1051.330275 1026.108374 958.3653846 932.8571429 914.6929825 884.1176471 844.8245614 1003.562232 1017.347826 943.2894737 900.7089552
C Dilution N/A 1 in 4 1 in 4 1 in 4.5 1 in 4.5 1 in 5 1 in 5 1 in 5.5 1 in 5.5 1 in 6 1 in 5.5 1 in 6.5 1 in 5.5
OD 0.269 0.239 0.225 0.22 0.203 0.24 0.218 0.225 0.225 0.231 0.244 0.236 0.237
YFP 291.95 243.21 233.06 207.05 195.54 221.06 202.99 193.67 188.6 233.191 242.86 219.04 218.02
YFP/OD 1085.315985 1017.615063 1035.822222 941.1363636 963.2512315 921.0833333 931.146789 860.7555556 838.2222222 1009.484848 995.3278689 928.1355932 919.9156118
P85 A Dilution N/A 1 in 4 1 in 4 1 in 4.5 1 in 4.5 1 in 5 1 in 5 1 in 5.5 1 in 5.5 1 in 6 1 in 5.5 1 in 6.5 1 in 5.5
OD 0.221 0.227 0.218 0.2 0.196 0.232 0.226 0.212 0.217 0.239 0.234 0.218 0.221
YFP 245.2 236.07 228.69 202.98 190.63 220.43 208.21 184.71 187.91 239.59 236.01 212.75 209.69
YFP/OD 1109.502262 1039.955947 1049.036697 1014.9 972.6020408 950.1293103 921.2831858 871.2735849 865.9447005 1002.468619 1008.589744 975.9174312 948.8235294
B Dilution N/A 1 in 4 1 in 4 1 in 4.5 1 in 4.5 1 in 5 1 in 5 1 in 5.5 1 in 5.5 1 in 6.5 1 in 5.5 1 in 6.5 1 in 5.5
OD 0.221 0.233 0.219 0.202 0.192 0.244 0.223 0.213 0.22 0.229 0.225 0.225 0.225
YFP 245.2 232.52 224.04 200.66 190.6 220 204.88 181.33 179.51 233.89 227.6 211.73 209.61
YFP/OD 1109.502262 997.9399142 1023.013699 993.3663366 992.7083333 901.6393443 918.7443946 851.314554 815.9545455 1021.353712 1011.555556 941.0222222 931.6
C Dilution N/A 1 in 4 1 in 4 1 in 4.5 1 in 4.5 1 in 5 1 in 5 1 in 5.5 1 in 5.5 1 in 6 1 in 6 1 in 6.5 1 in 5.5
OD 0.221 0.23 0.226 0.2 0.199 0.238 0.229 0.216 0.217 0.238 0.232 0.234 0.227
YFP 245.2 233.88 229.97 199.54 193.24 215.08 208.23 182.57 182.58 234.45 232.47 217.81 210.75
YFP/OD 1109.502262 1016.869565 1017.566372 997.7 971.0552764 903.697479 909.30131 845.2314815 841.3824885 985.0840336 1002.025862 930.8119658 928.4140969
(-) Ctrl (P41) A Dilution N/A 1 in 4 1 in 4 1 in 4.5 1 in 4.5 1 in 5 1 in 5 1 in 5.5 1 in 5.5 1 in 6 1 in 5.5 1 in 6.5 1 in 5.5
OD 0.216 0.232 0.215 0.197 0.199 0.237 0.221 0.217 0.223 0.234 0.237 0.226 0.234
YFP 234.27 227.67 216.53 186.19 198.19 214.86 204.3 190.44 205.31 236.74 234.19 211.12 215.13
YFP/OD 1084.583333 981.3362069 1007.116279 945.1269036 995.9296482 906.5822785 924.4343891 877.6036866 920.6726457 1011.709402 988.1434599 934.159292 919.3589744
B Dilution N/A 1 in 4 1 in 4 1 in 4.5 1 in 4.5 1 in 5 1 in 5 1 in 5.5 1 in 5.5 1 in 6 1 in 6 1 in 6.5 1 in 5.5
OD 0.216 0.227 0.234 0.199 0.197 0.235 0.223 0.217 0.219 0.242 0.233 0.225 0.228
YFP 234.27 237.44 226.99 190.07 186.35 215.29 210.32 190.44 188.45 239.24 234.96 209.83 207.08
YFP/OD 1084.583333 1045.991189 970.042735 955.1256281 945.9390863 916.1276596 943.1390135 877.6036866 860.5022831 988.5950413 1008.412017 932.5777778 908.245614
C Dilution N/A 1 in 4 1 in 4 1 in 4.5 1 in 4.5 1 in 5 1 in 5 1 in 5.5 1 in 5.5 1 in 6 1 in 6 1 in 6.5 1 in 5.5
OD 0.216 0.219 0.218 0.193 0.194 0.238 0.228 0.214 0.219 0.241 0.229 0.22 0.223
YFP 234.27 224.51 227.38 201.61 190.81 216.18 209.61 185.68 183.13 240.67 227.78 208.24 207.36
YFP/OD 1084.583333 1025.159817 1043.027523 1044.611399 983.556701 908.3193277 919.3421053 867.6635514 836.2100457 998.6307054 994.6724891 946.5454545 929.8654709


Data for the 1000fold Dilutions after 2 Hours

' ' ' Time ' ' ' ' ' ' ' ' '
2hrs Diluted 1000 fold, grown for 5 hours. Diluted 1000 fold, grown for 5 hours, diluted to same OD range.
Strain Replicate 30 30 + 1mM IPTG 40 42 30 30 + 1mM IPTG 40 42* DID NOT SHAKE FOR TWO HOURS IN THE MIDDLE. 40 42* DID NOT SHAKE FOR TWO HOURS IN THE MIDDLE.
LB N/A Dilution N/A N/A N/A N/A N/A N/A N/A N/A 1 in 10 1 in 10
OD 0 0 0 0 0 0 0 0 0 0
YFP 40.72 40.72 40.72 40.72 46.8 46.8 46.8 46.8 46.8 46.8
P84 A Dilution 1 in 4 1 in 4 1 in 4.5 1 in 4.5 N/A N/A N/A N/A 1 in 10 1 in 10
OD 0.229 0.218 0.216 0.214 0.018 0.015 0.12 0.139 0.015 0.018
YFP 242.89 226.53 216.85 211.21 63.52 59.56 164.97 169.15 59.29 61.78
YFP/OD 1060.655022 1039.12844 1003.935185 986.9626168 3528.888889 3970.666667 1374.75 1216.906475 3952.666667 3432.222222
B Dilution 1 in 4 1 in 4 1 in 4.5 1 in 4.5 N/A N/A N/A N/A 1 in 10 1 in 10
OD 0.221 0.218 0.203 0.208 0.015 0.016 0.134 0.127 0.02 0.018
YFP 225.35 229.19 208.3 199.34 62.13 63.2 169.54 170.49 61.6 62.48
YFP/OD 1019.683258 1051.330275 1026.108374 958.3653846 4142 3950 1265.223881 1342.440945 3080 3471.111111
C Dilution 1 in 4 1 in 4 1 in 4.5 1 in 4.5 N/A N/A N/A N/A 1 in 10 1 in 10
OD 0.239 0.225 0.22 0.203 0.017 0.016 0.131 0.127 0.021 0.016
YFP 243.21 233.06 207.05 195.54 60.86 62.2 164.97 163.9 59.74 64.82
YFP/OD 1017.615063 1035.822222 941.1363636 963.2512315 3580 3887.5 1259.312977 1290.551181 2844.761905 4051.25
P85 A Dilution 1 in 4 1 in 4 1 in 4.5 1 in 4.5 N/A N/A N/A N/A 1 in 10 1 in 10
OD 0.227 0.218 0.2 0.196 0.014 0.017 0.121 0.122 0.018 0.016
YFP 236.07 228.69 202.98 190.63 59.28 62.21 155.08 173.29 63.34 61.37
YFP/OD 1039.955947 1049.036697 1014.9 972.6020408 4234.285714 3659.411765 1281.652893 1420.409836 3518.888889 3835.625
B Dilution 1 in 4 1 in 4 1 in 4.5 1 in 4.5 N/A N/A N/A N/A 1 in 10 1 in 10
OD 0.233 0.219 0.202 0.192 0.014 0.012 0.121 0.114 0.018 0.016
YFP 232.52 224.04 200.66 190.6 60.47 56.56 149.74 175 60.99 57.54
YFP/OD 997.9399142 1023.013699 993.3663366 992.7083333 4319.285714 4713.333333 1237.520661 1535.087719 3388.333333 3596.25
C Dilution 1 in 4 1 in 4 1 in 4.5 1 in 4.5 N/A N/A N/A N/A 1 in 10 1 in 10
OD 0.23 0.226 0.2 0.199 0.015 0.013 0.126 0.107 0.021 0.016
YFP 233.88 229.97 199.54 193.24 57.31 58.69 171.68 148.36 60.58 63.76
YFP/OD 1016.869565 1017.566372 997.7 971.0552764 3820.666667 4514.615385 1362.539683 1386.542056 2884.761905 3985
(-) Ctrl (P41) A Dilution 1 in 4 1 in 4 1 in 4.5 1 in 4.5 N/A N/A N/A N/A 1 in 10 1 in 10
OD 0.232 0.215 0.197 0.199 0.016 0.015 0.111 0.133 0.019 0.018
YFP 227.67 216.53 186.19 198.19 65.69 65.34 150.96 162.94 60.46 59.28
YFP/OD 981.3362069 1007.116279 945.1269036 995.9296482 4105.625 4356 1360 1225.112782 3182.105263 3293.333333
B Dilution 1 in 4 1 in 4 1 in 4.5 1 in 4.5 N/A N/A N/A N/A 1 in 20 1 in 10
OD 0.227 0.234 0.199 0.197 0.029 0.027 0.228 0.125 0.021 0.022
YFP 237.44 226.99 190.07 186.35 71.71 71.9 241.84 160.57 59.6 61.7
YFP/OD 1045.991189 970.042735 955.1256281 945.9390863 2472.758621 2662.962963 1060.701754 1284.56 2838.095238 2804.545455
C Dilution 1 in 4 1 in 4 1 in 4.5 1 in 4.5 N/A N/A N/A N/A 1 in 10 1 in 10
OD 0.219 0.218 0.193 0.194 0.017 0.018 0.134 0.118 0.021 0.019
YFP 224.51 227.38 201.61 190.81 59.56 61.47 167.86 162.14 59.57 57.91
YFP/OD 1025.159817 1043.027523 1044.611399 983.556701 3503.529412 3415 1252.686567 1374.067797 2836.666667 3047.894737

Sequencing Parts, Plasmids, Etc.

Primers for Sequencing Remy's Plasmids and Duet Vectors 7/21

Primer Name Sequence
P4P13fwd GGATCTCGACGCTCTCCCTT
P12fwd ATGCGTCCGGCGTAGAGGA
DuetRev TGCTAGTTATTGCTCAGCGG

These arrived 7/25/08, and were reconstituted to 100uM.

Analytical Digest of Composite Parts 7/22

Digested composite plasmids to verify size.

Plasmid DNA Added (uL) 10x Buffer 3 (uL) 100x BSA (uL) XbaI (uL) PstI (uL) Water (uL) Total (uL) < 1 ug DNA? Expected Size
S1 P75a 1 (7/22) 7 2.5 uL 0.25 uL 1 uL 1 uL 13.25 25 uL 925bp, 2750bp
S1 P75a 2 (7/22) 5 2.5 uL 0.25 uL 1 uL 1 uL 15.25 25 uL 925bp, 2750bp
S1 P75b 1 (7/22) 7 2.5 uL 0.25 uL 1 uL 1 uL 13.25 25 uL 925bp, 2750bp
S1 P75b 2 (7/22) 4 2.5 uL 0.25 uL 1 uL 1 uL 16.25 25 uL 925bp, 2750bp
E1 P92a 1:1 (7/17) 7 2.5 uL 0.25 uL 1 uL 1 uL 13.25 25 uL 2314bp, 2750bp
E1 P92b 1:1 (7/17) 7 2.5 uL 0.25 uL 1 uL 1 uL 13.25 25 uL 2314bp, 2750bp
E1 P93a 1:1 (7/17) 7 2.5 uL 0.25 uL 1 uL 1 uL 13.25 25 uL 2314bp, 2750bp
E1 P93b 1:1 (7/17) 10 2.5 uL 0.25 uL 1 uL 1 uL 10.25 25 uL 2314bp, 2750bp
E1 P92a PCR (7/18) 15 2.5 uL 0.25 uL 1 uL 1 uL 5.25 25 uL Yes 2314bp, 2750bp
S1 P93 1:3 1 (7/17) 7 2.5 uL 0.25 uL 1 uL 1 uL 13.25 25 uL 2314bp, 2750bp
S1 P93 1:3 2 (7/17) 7 2.5 uL 0.25 uL 1 uL 1 uL 13.25 25 uL 2314bp, 2750bp
S1 P92a PCR 1 (7/18) 7 2.5 uL 0.25 uL 1 uL 1 uL 13.25 25 uL 2314bp, 2750bp
S1 P92a PCR 2 (7/18) 7 2.5 uL 0.25 uL 1 uL 1 uL 13.25 25 uL 2314bp, 2750bp
S1 P93b PCR 1 (7/18) 4 2.5 uL 0.25 uL 1 uL 1 uL 16.25 25 uL 2314bp, 2750bp
S1 P93b PCR 2 (7/18) 7 2.5 uL 0.25 uL 1 uL 1 uL 13.25 25 uL 2314bp, 2750bp
E1 P58b 1 (7/18) 7 2.5 uL 0.25 uL 1 uL 1 uL 13.25 25 uL 937bp, 2750bp
E1 P58b 2 (7/18) 10 2.5 uL 0.25 uL 1 uL 1 uL 10.25 25 uL 937bp, 2750bp
S1 P58b A (7/15) 10 2.5 uL 0.25 uL 1 uL 1 uL 10.25 25 uL Yes 937bp, 2750bp
S1 P58b B (7/15) 10 2.5 uL 0.25 uL 1 uL 1 uL 10.25 25 uL Yes 937bp, 2750bp
S1 P59 (7/9) 10 2.5 uL 0.25 uL 1 uL 1 uL 10.25 25 uL Yes 1122bp, 2750bp
S1 P59b 1 (7/22) 10 2.5 uL 0.25 uL 1 uL 1 uL 10.25 25 uL Yes 1122bp, 2750bp
S1 P59b 2 (7/18) 3 2.5 uL 0.25 uL 1 uL 1 uL 17.25 25 uL 1122bp, 2750bp

Gel Results 7/23

7-23-08 analyticaldigA.jpg 1% Agarose, visualized using EtBr/UV
Lane Sample
1 1 kB ladder
2 S1 P75a 1 (7/22)
3 S1 P75a 2 (7/22)
4 S1 P75b 1 (7/22)
5 S1 P75b 2 (7/22)
6 E1 P92b 1:1 (7/17)
7 E1 P92a 1:1 (7/17)
8 E1 P93a 1:1 (7/17)
9 E1 P93b 1:1 (7/17)
10 E1 P92a PCR (7/18)
11 S1 P93 1:3 1 (7/17)
12 S1 P93 1:3 2 (7/17)
7-23 analyticdig B ls.jpg 1% Agarose, visualized using EtBr/UV
Lane Sample
1 1 kB ladder
2 S1 P92a PCR 1 (7/18)
3 S1 P92a PCR 2 (7/18)
4 S1 P93b PCR 1 (7/18)
5 S1 P93b PCR 2 (7/18)
6 E1 P58b 1 (7/18)
7 E1 P58b 2 (7/18)
8 S1 P58b A (7/15)
9 S1 P58b B (7/15)
10 S1 P59 (7/9)
11 S1 P59b 1 (7/22)
12 S1 P59b 2 (7/18)

Making Thermoinducible cI Lambda System

Primers for Taking Out cI857 from PGW7 7/21

Primer Name Sequence
CI857_RBSfwd Atcgagaattcgcggccgcttctagagaaagaggagaaaatgagcacaaaaaagaaac
CI857_RBSrev Atcgatactagtagcggccgctgcagtcagccaaacgtctcttcag
CI857_BIGfwd Atcgagaattcgcggccgcttctagagtcatgacattaacctataaa
CI857_BIGrev atcgatactagtagcggccgctgcagcagccagcagagaattaagg

Minipreps of Transformed Parts in S1 7/22

Also includes transformed P28 and the thermoinducible lac system.

Plasmid Name ng/uL A260 260/280 260/230 Constant
S1 P75a 1 156.2 3.124 1.99 2.27 50
S1 P75a 2 203.24 4.065 2.04 2.23 50
S1 P75b 1 177.41 3.548 2.02 2.16 50
S1 P75b 2 258.85 5.177 2.01 2.3 50
S1 P28a 1 155.42 3.108 2.03 2.27 50
S1 P28a 2 239.51 4.79 2.06 2.26 50
S1 P28a 3 204.5 4.09 2.01 2.24 50
S1 P93 1:3 1 175.27 3.505 2.07 2.32 50
S1 P93 1:3 2 166.9 3.338 2.12 2.38 50
S1 P92a PCR 1 152.58 3.052 2.02 2.28 50
S1 P92a PCR 2 157.59 3.152 2.02 2.22 50
S1 P93b PCR 1 291.87 5.837 2.13 2.23 50
S1 P93b PCR 2 152 3.04 2.07 2.21 50

Adding Terminator Before pLambda GFP

Digestion of Terminator (P64) and pLambda GFP 7/22

' P75a 1 (vector) P75b 1 (vector) P64a 07 (insert)
DNA 10 uL 10 uL 10 uL
100x BSA 0.25 uL 0.25 uL 0.25 uL
10x Buffer 2.5 uL EcoRI buffer 2.5 uL EcoRI buffer 2.5 uL EcoRI buffer
Enzyme 1 1 uL EcoRI 1 uL EcoRI 1 uL EcoRI
Enzyme 2 1 uL XbaI 1 uL XbaI 1 uL SpeI
Water 5.25 uL 5.25 uL 5.25 uL
Total 25 uL 25 uL 25 uL


Digestion Gel Results 7/23

7-23 digest lts.jpg 1% Agarose, visualized using EtBr/UV
Lane Sample
1 1kB Ladder
3 S1 P75a (2750/925)
4 100bp Ladder
5 S1 P75b 1 (2750/925)
7 P64a 07 (~3kb/129bp)
9 1kB Ladder

Extracted and purified S1 P75a 1 and P75b 1, but P64 07 has incorrect bands.

Desphosphorylated S1 P75a 1 and P75b 1 same day.

Digestion of (Almost) All of Our Terminators 7/23

' P41 P61 P62a 07 P64
DNA 5 uL 8 uL 8 uL 8 uL
100x BSA 0.25 uL 0.25 uL 0.25 uL 0.25 uL
10x EcoRI Buffer 2.5 uL 2.5 uL 2.5 uL 2.5 uL
Enzyme 1 1 uL EcoRI 1 uL EcoRI 1 uL EcoRI 1 uL EcoRI
Enzyme 2 1 uL SpeI 1 uL SpeI 1 uL SpeI 1 uL SpeI
Water 15.25 uL 15.25 uL 15.25 uL 15.25 uL
Total 25 uL 25 uL 25 uL 25 uL

Gel? 7/24

Faint band was detected in P64 (?) but was not visible under UV when cutting, so not extracted. Will try digestion of P63, which has worked for Meng Xiao and Thilini before.

Ligation of P75 with old P63 7/24

Purified P63 cut with ES was ligated with the dephosphorylated P75 vector. Very little of the insert was available (~2 uL)

Transformed on Kan plates.

7/25: Almost all plates were blank except for positive control. One faint, questionable colony found on plate with 1 uL ligation reaction-- picked for Saturday.

Digestion of P63 (7/24) and E1 P75b (7/25)

' P63a P63b E1 P75b
DNA ? ? 10 uL
100x BSA 0.25 uL 0.25 uL 0.25 uL
10x EcoRI Buffer 2.5 uL 2.5 uL 2.5 uL
Enzyme 1 1 uL EcoRI 1 uL EcoRI 1 uL EcoRI
Enzyme 2 1 uL SpeI 1 uL SpeI 1 uL XbaI
Water ? ? 10.25 uL
Total 25 uL 25 uL 25 uL

Gel Results 7/25

7-25 digest lts.jpg 1% Agarose, visualized using EtBr/UV
Lane Sample
3 E1 P75b (2750/ 925 bp)
5 1 kb Ladder
7 P63a (95 bp)
8 100 bp Ladder
9 P63b (95 bp)

95 bp bands became fainter (and undetectable with gel mold on) after running the gel for more time.

E1 P75b, P63a, and P63b were extracted and purified. E1 P75b was dephosphorylated using the Roche T4 Ligation Kit Alkaline Phosphatase.

Ligation of pLambda+GFP Vector P75 with Terminator P63 7/25

' E1 P75b + P63a (6:2) E1 P75b + P63b (6:2) S1 P75a + P63a (6:2) S1 P75a + P63b (6:2) S1 P75b + P63a (6:2) S1 P75b + P63b (6:2) E1 P75b + P63a (5:1) E1 P75b + P63b (5:1) S1 P75a + P63a (5:1) S1 P75b + P63b (5:1)
Insert 6 uL 6 uL 6 uL 6 uL 6 uL 6 uL 5 uL 5 uL 5 uL 5 uL
Vector 2 uL 2 uL 2 uL 2 uL 2 uL 2 uL 1 uL 1 uL 1 uL 1 uL
DNA Dilution Buffer 2 uL 2 uL 2 uL 2 uL 2 uL 2 uL 2 uL 2 uL 2 uL 2 uL
Water (to 20 uL) 0 uL 0 uL 0 uL 0 uL 0 uL 0 uL 2 uL 2 uL 2 uL 2 uL
Ligation Buffer 10 uL 10 uL 10 uL 10 uL 10 uL 10 uL 10 uL 10 uL 10 uL 10 uL
Ligase 1 uL 1 uL 1 uL 1 uL 1 uL 1 uL 1 uL 1 uL 1 uL 1 uL

Transformation of P75+ P63 Ligations and PGW7

Plate Marker # Colonies Plate Description
E1 P75b + P63a (6:2) Kan 0
E1 P75b + P63b (6:2) Kan 0
S1 P75a + P63a (6:2) Kan 1 Single colony is fluorescent.
S1 P75a + P63b (6:2) Kan 0
S1 P75b + P63a (6:2) Kan 1 Single colony NOT fluorescent.
S1 P75b + P63b (6:2) Kan 0
E1 P75b + P63a (5:1) Kan 0
E1 P75b + P63b (5:1) Kan 0
S1 P75a + P63a (5:1) Kan 0
S1 P75b + P63b (5:1) Kan 0
PGW7 1 (1 uL plasmid in 50 uL cells) Amp 200+
PGW7 2 (1 uL plasmid in 100 uL cells) Amp 200+
puc19 30s Heatshock Amp 18
puc19 45s Heatshock Amp 15
puc19 1m Heatshock Amp 6
puc19 2m Heatshock Amp 14
Kan (-) ctrl Kan 0
Amp (-) ctrl Amp 0

Gradient PCR of PGW7 Plasmid to Isolate cI857 7/25

Used primer sets RBS and BIG. Prepared enough for 4 standard reactions (50 uL each), and split into 8 reactions in strip top tubes.

Reaction Recipe:

Fwd Primer 1 uL
Rev Primer 1 uL
Platinum Supermix 45 uL
Water 2 uL

Added a total of 2 uL of PGW7 plasmid to each reaction mix (0.25 uL plasmid per 25 uL reaction).

PCR Gels 7/25

PCR using RBS Primer Set:

  • Amplified region is cI857 coding region only, and primers have Biobricks prefix, suffix, and RBS.
  • 675bp
7-25-08 cI857 RBS al.jpg 1% Agarose, visualized using EtBr/UV
Lane Annealing Temperature
1 100 bp Ladder
2 40.8
3 41.5
4 42.5
5 43.9
7 100bp Ladder
8 45.4
9 46.7
10 47.6
11 48.3
13 1 kB Ladder

All bands were extracted and purified.

PCR using BIG Primer Set:

  • Amplified region is cI857 coding region and 200bp upstream and downstream, and primers have Biobricks prefix and suffix.
  • 1193bp
7-25-08 cI857 BIG al.jpg 1% Agarose, visualized using EtBr/UV
Lane Annealing Temperature
1 1 kB Ladder
2 40.8
3 41.5
4 42.5
5 43.9
6 45.4
7 46.7
8 47.6
9 48.3
10 100 bp Ladder

All bands were extracted and purified.

Housekeeping

Making Competent Cells 7/22

Made ~600 100uL (some were 200 uL, indicated by green dot on top) aliquots from 1L of culture. Done as per Jason's lab's protocol.

New cells seem to work, but tested heatshock times with puc19 7/25/08.


Ligations 07/22

  • Attempted to ligate p40 cut with SP (w/ RBS) to mtrB cut with XP. Thus far, the ligation has not worked.

Recombination Update 07/22

  • Thus far, none of the attempts to extract flanking regions from the genomic DNA have worked. We are troubleshooting this now and will run positive controls with known DNA samples to check the efficiency of our Phusion Polimerase.

07/23 Ligations/Transformations

  • Ligated p40 cut SP with mtrB cut XP at 2:3, 1:2, 1:4, 1:5, 1:6, positive control is uncut p40, negative control (to test Amp plates) is p29 (Kan)

Ligations 07/24

We ligated p75a w/ p63 w/ a ratio of 4ul p63:1ul p75a

Transformed into new dh5α competent cells w/ volumes of 1, 3, and 5uL, using Jason's new protocol. As a control transformed 1uL of pUC19.

PCR

mtrB

7/22: gradient + new R primer

Rx mix (split into 12 samples): 180μL PCR supermix, 4μL mtrB-ApaLI-F primer (20μM), 4μL mtrB-KpnI-R-new (20μM), pipet tip touch of mtrB BB from gel purification, 12μL water Rx: 5min @ 94°C → 35x[45s @ 94°C → 45s @ {52-58 gradient}°C → 2m38s @72°C] → 5min @ 72°C → ∞ @ 4°C

No bands on gel from any of the conditions.

Lower gradient

Rx mix (split into 12 samples): 180μL PCR supermix, 4μL mtrB-ApaLI-F primer (20μM), 4μL mtrB-KpnI-R-new (20μM), pipet tip touch of WT S. oneidensis MR-1, 12μL water Rx: 10min @ 94°C → 40x[45s @ 94°C → 45s @ {44-51 gradient}°C → 2m45s @72°C] → 5min @ 72°C → ∞ @ 4°C

7/23: gel

All the temperatures seem to have worked (51 was not loaded due to # lanes on gel). Expected product size ~2.1kb. Ladder is 1KB.

Products from different temperatures combined and gel purified.

7-23 mtrB nonBB mxh.jpg

P51, 52, 17 MIT

17, 52:
Rx mix (split into 4 samples): 180μL Platinum PCR supermix, 4μL BBpfx primer (20μM), 4μL BBsfx primer (20μM), 4μL miniprepped DNA, 8μL water
51:
Rx mix (split into 4 samples): 100μL AmpliTaq Gold Master Mix, 4μL BBpfx primer (20μM), 4μL BBsfx primer (20μM), 4μL miniprepped DNA, 88μL water

Rx: 5min @ 94°C → 35x[45s @ 94°C → 45s @ {52.7, 53.6, 54.6, 55.5}°C → 1m25s @72°C] → 5min @ 72°C → ∞ @ 4°C

Results

2008-07-23 pcr mxh.jpg 1.2% agarose E-gel run for 30 min and visualized using EtBr/UV
Lane Contents
1-4 P17 (902) (annealing temp increase LTR)
5-8 P51 (1370) (annealing temp increase LTR)
9-11 P53 (987) (annealing temp increase LTR)
12 1KB plus ladder

P1, P3 backbones; HO-pcyA; P51 MIT

Conditions optimization

Rx: 5min @ 94°C → 35x[45s @ 94°C → 45s @ {middle 8 of 41-55 gradient: 43.3, 44.9, 47.0, 49.3, 51.3, 52.8, 53.9, 54.7}°C → 3m30s @72°C] → 5min @ 72°C → ∞ @ 4°C

P1, P3

PCR product is the backbone of P1 and P3, including the RBS (B0032), weak and strong promoter respectively, and terminator. The ends have unique ApaLI and KpnI cut sites.

Rx mix (split into 8 samples): 180μL Platinum PCR supermix, 4μL P3minusGFP-F primer (20μM), 4μL P3minusGFP-R primer (20μM), 4μL miniprepped DNA (P1/P3), 8μL water

HO-pcyA

Ends have unique ApaLI and KpnI cut sites.

Rx mix (split into 8 samples): 180μL Platinum PCR supermix, 4μL HO-pcyA-F primer (20μM), 4μL HO-pcyA-R primer (20μM), 4μL miniprepped P86, 8μL water

P51 MIT

Rx mix (split into 4 samples): 90μL Platinum PCR supermix, 2μL BBsfx primer (20μM), 2μL BBpfx primer (20μM), 2μL miniprepped P51, 4μL water

Used highest 4 temps of gradient.

Gels

Annealing temp increases LTR.

2008-07-24 pcr 1 mxh.jpg 1.2% agarose E-gel run for 30 min and visualized using EtBr/UV
Lane Contents
1-8 P1 backbone (~3kb)
9 1 KB ladder
10-12 HO-pcyA (~1.4 kb)
2008-07-24 pcr 2 mxh.jpg 1.2% agarose E-gel run for 30 min and visualized using EtBr/UV
Lane Contents
1-5 HO-pcyA (~1.4 kb)
6 1 KB ladder
7-12 P3 backbone (~3 kb)
2008-07-24 pcr 3 mxh.jpg 1.2% agarose E-gel run for 30 min and visualized using EtBr/UV
Lane Contents
1-2 P3 backbone (~3kb)
3 1 KB ladder
4-7 P51 MIT (~1.4 kb)

Full Rx

400 μL (8 reactions) each of P1 and P3 were set up using a doubling of above reaction mix. The reaction conditions were the same except that annealing temperature was 45°C, and cycles occur 40 times.

100 μL (2 reactions) each of HO-pcyA and P51 MIT were set up using above reaction ratios. 40 cycles were performed with 55°C annealing temp and 1:35 extension time.

Products will be gel purified along with products from optimization PCRs.

RE digests 07/22

Gel 1

7-22 gel 1 MXHTA.jpg 1 agarose gel visualized using EtBr/UV
Lane Contents
1 1 kb plus ladder
2 CDF PCR cut XP (~900)
3 CDF PCR uncut (~900)
4 P1A cut XP (2750)
5 P1A uncut (3669)
6 P17 cut EX (5327)
7 P17 uncut (5327)
8 P48 cut XP (769)
9 P48 uncut (3477)

Gel 2

7-22 gel 2 MXHTA.jpg 1 agarose gel visualized using EtBr/UV
Lane Contents
1 1 kb plus ladder
2 P49B cut XP (943)
3 P49B uncut (3651)
4 P51 cut EX (5795)
5 P51 uncut (5795)
6 P52 cut EX (5412)
7 P52 uncut (5412)
8 P63 cut EX (3284)
9 P63 uncut (3284)


Gel 3

7-22 gel 3 MXHTA.jpg 1 agarose gel visualized using EtBr/UV
Lane Contents
1 1 kb plus ladder
2 P97A cut EX (2091)
3 P97A uncut (2091)
4 P97B cut EX (2091)
5 P97B uncut (2091)

Ligation w/ purified products 7/22: CDF into P1 vector

  • We ligated P1A (vector) to CDF. We used three different ratios of vector to insert for the ligation: 2/6, 1/5, 1/7.

RE digests 07/23

Gel 1: 1% agarose gel visualized using EtBr/UV Lane Contents
7-23 gel 1 MXHTA.jpg 1 1 kb plus ladder
2 P97A cut SP (2091)
3 P97A uncut
4 P97B cut SP (2091)
5 P97B uncut
6 P51 cut EX (5795)
7 P51 uncut
8 P52 cut EX (5412)
9 P52 uncut
10 P90ζ cut SP (~3600)
11 P90ζ uncut
12 P90ε cut SP (~3600)
13 P90ε uncut
14 mtrB (not BioBrick) uncut PCR product (~2.1kb)
Gel 2: 1% agarose gel visualized using EtBr/UV Lane Contents
7-23 gel 2 MXHTA.jpg 1 1 kb plus ladder
2 P17 cut EX (5327)
3 P17 uncut
4 S1P3A B cut XP (2750)
5 S1P3A B uncut
6 S1P3A C cut XP (2750)
7 S1P3A C uncut
8 P3A cut XP (2750)
9 P3A uncut
10 P3B cut XP (2750)
11 P3B uncut
12 mtrB BB cut XP (2100)
13 mtrB BB uncut

Ligations with purified digest fragments 07/23: mtrB+RBS, CDF into pSB3K3

We ligated

  • P97 and mtrB BB
  • P3 and CDF

We used three different ratios of insert to vector for the ligation: 6/2, 5/1, 7/1.

We used 5 μL of the ligation to transform TOP10 cells and 5 μL to transform the new DH5α cells. We also used 1 μL and 3 μL to transform DH5α. We used pUC19 (1 μL) as a positive control to test the efficacy of the new DH5α cells.

We used Jason's protocol to transform the new DH5α cells:

  • Thaw cells by resting tubes on ice
  • Then add DNA and mix by swirling with the pipette tip
  • Incubate the cells with DNA in ice for 10min
  • Heat shock at 42C for 2min
  • Then incubate in ice for 2-5min
  • Add 500-700ml LB (or SOC) and incubate + 250rpm shaking for 1hr at 37C
  • Plate

Results

Strain DNA Vector:Insert (μL) Amount transformed (μL) Plate # colonies
E1 pUC19 n/a 1 AMP 40
E1 - n/a - CARB 0
E2 P97+ mtrB BioBrick 2:6 5 CARB 136
E2 P97+ mtrB BioBrick 1:5 5 CARB 48
E2 P97+ mtrB BioBrick 1:7 5 CARB 64
E1 P97+ mtrB BioBrick 1:7 1 CARB 0
E1 P97+ mtrB BioBrick 1:7 3 CARB 0
E1 P97+ mtrB BioBrick 1:7 5 CARB 4
E1 P97+ mtrB BioBrick 1:5 1 CARB 0
E1 P97+ mtrB BioBrick 1:5 1 CARB 0
E1 P97+ mtrB BioBrick 1:5 1 CARB 0
E1 P97+ mtrB BioBrick 2:6 1 CARB 1
E1 P97+ mtrB BioBrick 2:6 1 CARB 7
E1 P97+ mtrB BioBrick 2:6 1 CARB 9
E2 P3+CDF 2:6 5 KAN 7
E2 P3+CDF 1:5 5 KAN 56
E2 P3+CDF 1:7 5 KAN 5
E1 P3+CDF 1:7 1 KAN 0
E1 P3+CDF 1:7 3 KAN 2
E1 P3+CDF 1:7 5 KAN 0
E1 P3+CDF 1:5 1 KAN 0
E1 P3+CDF 1:5 3 KAN 0
E1 P3+CDF 1:5 5 KAN 0
E1 P3+CDF 2:6 1 KAN 0
E1 P3+CDF 2:6 3 KAN 1
E1 P3+CDF 2:6 5 KAN 0
  • Try 45s heat shock and SOC for new cells
  • Try 3 or 5 μL transformations
  • New Carb plates seem fine

RE digests of miniprepped ligations 07/25

7-25 gel 1 MXHTA.jpg

Lane 1: 1 kb ladder

Lanes 2-7: P90 A-F cut SP (~3600)

Lanes 8-13: P98 A-F cut ES (~2100)

Lane 14: P3 cut XP (2750)

Ligations with purified parts and PCR products 07/26

Ligations were performed using standard protocol. New homemade cells were heat shocked for 40s, and incubated in 200μL SOC for 1 hour prior to plating on prewarmed plates. Vectors were dephosphorylated with Antarctic Phosphatase as per NEB's protocol.

Results 7/27
DNA Strain Vector,Insert Plate No. of Colonies
P3+HO-pcyA not BB PCR E1 3,5 Kan 1
P3+HO-pcyA not BB PCR E2 2,6 Kan ~50
P1+HO-pcyA not BB PCR E2 2,6 Kan ~50
P1+HO-pcyA not BB PCR E1 3,5 Kan 0
P1+mtrB not BB PCR E2 2,6 Kan 32
P1+mtrB not BB PCR E1 3,5 Kan 0
P3+mtrB not BB PCR E1 3,5 Kan 13
P3+mtrB not BB PCR E2 2,6 Kan ~80
P63+98 E1 1,7 Amp TMTC
P63+98 E2 2,6 Amp TMTC
P3+51 PCR E2 2,6 Kan ~120
P3+51 PCR E1 3,5 Kan 59
P90+49 E1 1.5,6.5 Amp TMTC
P90+49 E2 2,6 Amp TMTC
P90+48 E1 1.5,6.5 Cm ~80
P90+48 E2 2,6 Cm TMTC
pUC19 (positive control) E1 1 ul Carb ~200

2 non-fluorescent colonies picked for 5mL cultures for each plate when possible.

RE digests 07/24

7-24 gel 1 MXHTA.jpg 1% agarose gel visualized using EtBr/UV
Lane Contents
1 1 kb ladder
2 P1A uncut (~3600)
3 P1A cut EP (~2750)
4 P3A uncut (~3600)
5 P3A cut EP (~2750)
6 P17 PCR cut XP (902)
7 P52 PCR cut XP (987)
8 P90.4 uncut (~3600)
9 P90.1 cut SP (~3600)
10 P90.2 cut SP (~3600)
11 P90.3 cut SP (~3600)
12 P90.4 cut SP (~3600)

Ligations w/ purified digest fragments 07/24

Vector:insert ratio: 2:6 μL, volume used in transformation: 4μL

Note that 45s heat shock was used for DH5α, and cells were split onto 2 plates to accelerate drying.

Results 7/25

DNA Strain Plate # Colonies
P1+P17 E2 KAN 184
P1+P17 E1 KAN 9
P1+P17 E1 KAN 9
P1+P52 E2 KAN 40
P1+P52 E1 KAN 0
P1+P52 E1 KAN 0
P3+P17 E2 KAN 10
P3+P17 E1 KAN 0
P3+P17 E1 KAN 0
P3+P52 E2 KAN 48
P3+P52 E1 KAN 1
P3+P52 E1 KAN 1
P38+P17 E2 KAN 1
P38+P17 E1 KAN 0
P38+P17 E1 KAN 0
P38+P51 E2 KAN 32
P38+P51 E1 KAN 1
P38+P51 E1 KAN 0
P38+P52 E2 KAN 1
P38+P52 E1 KAN 0
P38+P63 E1 KAN 0
P39+P17 E1 KAN 0
P39+P17 E1 KAN 0
P39+P17 E2 KAN 0
P39+P51 E2 KAN 5
P39+P51 E1 KAN 2
P39+P51 E1 KAN 2
P39+P52 E2 KAN 6
P39+P52 E1 KAN 1
P39+P52 E1 KAN 1
P90+P48 E2 CM 16
P90+P48 E1 CM 5
P90+P48 E1 CM 1
P90+P49 E2 AMP TMTC
P90+P49 E1 AMP 19
P90+P49 E1 AMP 4
pUC19 E1 AMP 192

Cultures for miniprep

When possible, 2 non-fluorescent colonies were picked from each plate (fluorescence in the P1/P3 derived plasmids indicates P1/P3 vector religation).

  • The 2 E2 P90+49 cultures failed to grow. Note that Kan selection was used, as that's carried on P90, although the transformation plates were Amp.

RE digests of minipreps 07/26

We digested

  • P46 with NheI
  • P90+49 and P90+48 with XbaI and SpeI
  • When these parts are combined, we will have a plasmid with the CDF origin (CDF+Amp and CDF+Cm in the base vector)
  • P3+17 and P1+17 with EcoRI and XbaI
  • We can add the high and low constitutive promoters to give us the complete Tet system (without GFP) in a p15A vector
  • P39+51, P38+51, P38+17 with XbaI and PstI
  • We can put these parts into P1 and P3 to give us the complete Tet and Lac systems in a p15A vector

Results

Gel 1: 1% agarose gel visualized using EtBr/UV Lane Contents (expected band sizes)
2008-07-27 gel1 mxh.jpg
1 1KB PLUS LADDER
2 E2 90+48A XS (1650+2750)
3 E2 90+48B XS (1650+2750)
4 E1 90+48A XS (1650+2750)
5 E1 90+48B XS (1650+2750)
6 E1 90+48C XS (1650+2750)
7 E1 90+49A XS (1800+2750)
8 E1 90+49B XS (1800+2750)
9 E1 39+51A XP (1400+4425)
10 E2 39+51B XP (1400+4425)
11 E2 39+51A XP (1400+4425)
12 E1 90+49D XS (1800+2750)
13 E1 90+49C XS (1800+2750)
14 E1 39+51B XP (1400+4425)
15 E1 39+51C XP (1400+4425)
Gel 2: 1% agarose gel visualized using EtBr/UV Lane Contents (expected band sizes)
2008-07-27 gel2 mxh.jpg
1 E1 39+51D XP (1400+4425)
2 E2 38+51A XP (1400+4425)
3 E2 38+51B XP (1400+4425)
4 E2 38+17 XP (950+2750)
5 E1 38+51 XP (1400+4425)
6 P46B NheI (943+1495)
7 E1 1+17A EX
8 E1 1+17B EX
9 E1 1+17C EX
10 E1 1+17D EX
11 E2 1+17A EX
12 E2 1+17B EX
13 E2 3+17A EX
14 E2 3+17B EX
15 P1B XP (919+2750)
16 P3A XP (919+2750)
17 1KB PLUS LADDER

Cultures were set up again for samples 7-14, since the DNA seems to have not run properly.