IGEM:Harvard/2006/DNA nanostructures/Notebook/2006-8-2

From OpenWetWare
Jump to navigationJump to search

PEG precipitation

  • Goal: repeat titration of PEG precipitation conditions for 6hb
  • Folding reactions
    • 6 samples of 6hb (100 μL final volume)
    • Mix the following:
      • 10 uL 500 mM HEPES pH 7.5, 500 mM NaCl, 100 mM MgCl2
      • 40 uL working stock 250 nM each oligo (100 nM each oligo final concentration)
      • 50 uL p7308 20 nM (10 nM final concentration)
    • Anneal from 80[[:Category:{{{1}}}|{{{1}}}]] to 20[[:Category:{{{1}}}|{{{1}}}]], -1[[:Category:{{{1}}}|{{{1}}}]] per min
  • PEG precipitations
  • Plan to use 200 μL final volume
  • Trying 3%, 4%, 5%, 10%, 14%
  • Add 40 μL 10 nM scaffold/100 nM oligo folded mix
  • Add 20% PEG solution (30 μL, 40 μL, 50 μL, 100 μL, 140 μL)
  • Add 5 M NaCl stock solution (20 μL)
  • Add as much water to each as it takes to get them to a 200 μL final volume
  • Incubate on ice for 15 minutes
  • Spin 16k rcf for 10 minutes
  • Pipette out supernatant into separate tube
  • Resuspend pellet in 1x folding buffer volume equal to the supernatant
  • Run equivalent volumes of pellet and sup on 2% agarose gel (+ 11 mM MgCl2)
  • Gel Analysis
    • Analyze on 2% Mg agarose gel (0.5x TBE, 11 mM MgCl2, 0.5 μg/mL EtBr)
    • Load 1kb ladder (1 lane)
    • Load c5 supernatant, pellet for 0%, 4%, 6%, 8%, 10%, 12%, 14% (13 lanes)
    • Load 6hb supernatant, pellet for 0%, 4%, 14% (5 lanes)
    • 19 lanes total
File:IGEM06-080206.jpg
2% agarose gel, 0.5 mg/mL EtBr
0.5x TBE, 11 mM MgCl2
Lane Contents Loading Dye
0 1kb DNA ladder (4 μL) 0 μL
1 6hb untreated (10 μL) 2 μL
2 6hb 3% PEG supernatant (10 μL) 2 μL
3 6hb 3% PEG pellet (10 μL) 2 μL
4 6hb 4% PEG supernatant (10 μL) 2 μL
5 6hb 4% PEG pellet (10 μL) 2 μL
6 6 hb 5% PEG supernatant (10 μL) 2 μL
7 6 hb 5% PEG pellet (10 μL) 2 μL
8 6 hb 10% PEG supernatant (10 μL) 2 μL
9 6 hb 10% PEG pellet (10 μL) 2 μL
10 6 hb 14% PEG supernatant (10 μL) 2 μL
11 6 hb 14% PEG pellet (10 μL) 2 μL

SYBR Gold and silver staining

Error creating thumbnail: File missing
18% PAGE, stained with SYBR Gold, imaged through EtBr photographic filter
Error creating thumbnail: File missing
18% PAGE, stained with silver stain
  • goal: see how little ssDNA we can image with both SYBR gold and silver staining
lane DNA (3.2.8.1)
(13.9 pg DNA / fmol)
water (μL)
(μL) (fmols) (pg)
1 15 μL 1 μM 15,000 209,000 0
2 10 μL 1 μM 10,000 139,000 5
3 5 μL 1 μM 5,000 69,500 10
4 2.5 μL 1.0 μM 2,500 34,800 12.5
5 1 μL 1.0 μM 1,000 13,900 14
6 5 μL 0.1 μM 500 6,950 10
7 2.5 μL 0.1 μM 250 3,480 12.5
8 1 μL 0.1 μM 100 1,390 14
9 5 μL 0.01 μM 50 695 10
10 2.5 μL 0.01 μM 25 348 12.5
11 1 μL 0.01 μM 10 139 14
12 10 μL 1kb+ ladder 5
  • loaded in two gels
  • ran at 130V for 30 min.
  • stained on in silver stain (fixative time: ~25 min., staining time: ~15 min.), the other in SYBR gold (see protocols)
  • results/discussion:
    • silver stains these DNAs negatively (background stains but DNAs do not)
      • sensitive to 13,900 pg = 1,000 fmols (hardly visible in photograph, but visible on gel)
      • this is poor sensitivity
    • SYBR gold stains to 1,390 pg = 100 fmols
      • photograph was clearer with EtBr filter than with SYBR gold filter
      • oligo sample is not a single oligo (see lanes 1-4), implying that sensitivity is actually greater than 1,390 pg (maybe as much as 2x as sensitive)
      • this is good sensitivity, and should be sensitive enough to image digested ligands (assuming that digest yields are greater than about 100 fmols, which corresponds to about 30% yield)
      • this is better sensitivity than EtBr, which can image 1 ng (1,000 pg) of dsDNA, but doesn't stain ssDNA as well

More Ordering: v4.0 Attachment-Oligos, Oligo-ligand

v4.0 attachment-oligos and oligo-ligand order form, in tubes

  • Ordered tubes of v4.0 attachment-oligos and a tube of oligo-ligand.
  • Because the IDT order rejected the oligos that were 14nt long, those oligos were re-split in a different way so that they would be longer. This means that the two liganded-oligos for each of these original oligos (v4.0.6.3 and v4.0.6.4) are NOT to be used from this order. A second order was placed for these two oligos:
c4.0.6.3oa2
GCAAGGCCGGAAACGTCACCACGGCATT

c4.0.6.3ob2
TTCGGTCAGCCGCC TTTTTTTT CCGCGGGCGCGCCCC

c4.0.6.4oa2
TCCAAGAACGGGTATTAAACCAAGCCGT

c4.0.6.4ob2
TTTTATTTGCTATT TTTTTTTT CCGCGGGCGCGCCCC

Thus, DO NOT USE v4.0.6.3ob or v4.0.6.4ob! Wait until v4.0.6.3oa2, v4.0.6.3ob2, v4.0.6.4oa2, v4.0.6.4ob2 come in!

AscI digestion protocol proposal

Initial test, just oligos

Start by trying to digest ~25 ng DNA.

1 unit = enough enzyme to digest 1 μg DNA at 37[[:Category:{{{1}}}|{{{1}}}]] in 1 h in a total reaction volume of 50 μL [1]

  • = enough enzyme to digest 5 μg DNA at 37[[:Category:{{{1}}}|{{{1}}}]] in 1 h in a total reaction volume of 10 μL
  • = enough enzyme to digest 1 μg DNA at 37[[:Category:{{{1}}}|{{{1}}}]] in 12 min. in a total reaction volume of 10 μL

Mix together:

  • 998 fmols (14.0 ng) ligand DNA (MW = 14,027 Da [2]) = 1 μL 1 μM
  • 1 pmol (? ng) attachment DNA (MW = ?) = 1 μL 1 μM
  • 2 μL 10x BSA
  • 2 μL 10x NEBuffer 4 [3]
  • 25 ng DNA should require 0.025 units (25 milliunits) for a 12-minute digest. Do the following trials:
    • no enzyme, 12-minute digest
    • no enzyme, 24-minute digest
    • 50 milliunits (1 μL 50 milliunits/μL), 12-minute digest
    • 500 milliunits (1 μL 500 milliunits/μL), 12-minute digest
    • 50 milliunits (1 μL 50 milliunits/μL), 24-minute digest
    • 500 milliunits (1 μL 500 milliunits/μL), 24-minute digest
  • water to 20 μL

Incubate samples at 37[[:Category:{{{1}}}|{{{1}}}]] for specified time. Run on an 18% PA gel.

Test with nanostructures

Incubation step:

  • incubate unpurified nanostructrures with 10x excess ligand DNA
  • purify nanostructures

Digest step:

  • 100 fmols (~450 ng) purified, ligand-incubated nanostructures (MW ~= 4,500,000 Da) = 10 μL 10 nM
  • add 2 μL 10x BSA, 2 μL 10x NEBuffer 4, 2 μL of the appropriate AscI dilution as above (perhaps adjust concentrations based on initial results), and water to 20 μL
  • run the same 6 trials as in the initial test (two without enzyme are negative controls)
  • also run positive controls (which will verify that digest is working, as well as act as a sort of ladder)
    • ligand DNA and attachment DNA
    • ligand DNA and attachment DNA + BSA + buffer + AscI (amount determined by initial tests)

Incubate all trials at 37[[:Category:{{{1}}}|{{{1}}}]] for appropriate time.