IGEM:Harvard/2006/DNA nanostructures/Container Design 3/version2oligo list

From OpenWetWare
Jump to: navigation, search
Plate	Row	Column	Name	5' Mod	(Ensure sequences are in ALL CAPS)
3.2 p1	A	01	c.3.2.1.1		TAAAGTATAGCATT
3.2 p1	A	02	c.3.2.1.2		CAGGCAAAGCGCCATTCGCCACAGCTTTCCGGCACATAACCT
3.2 p1	A	03	c.3.2.1.3		GTTTAGCTATATTTTCATTTGTTCTGCGAACGAGTAGATTTA
3.2 p1	A	04	c.3.2.1.4		GTTTGACTCCTTTTGATAAGAAAACTCCAACAGGTAACGAGA
3.2 p1	A	05	c.3.2.1.5		ATGACCATAAATCAAAAATCAGAATCGTCATAAATATTCATT
3.2 p1	A	06	c.3.2.1.6		GAATCCCATAGTAAGAGCAACAACTAATGCAGATACATTGTG
3.2 p1	A	07	c.3.2.1.7		AATTACCTTATGCGATTTTAATGCTCCATGTTACTCGAAAGA
3.2 p1	A	08	c.3.2.1.8		GGCATTTGTCACAATCAATAGCCCAAAAGAACTGGTAACGTC
3.2 p1	A	09	c.3.2.1.9		AAAAATGCAGCTACAATTTTATCCTGAATCTTACCAGAACGC
3.2 p1	A	10	c.3.2.1.10		GAGGCGTTCGAGAACAAGCAATCCCATCCTAATTTACGAGCA
3.2 p1	A	11	c.3.2.1.11		TGTAGAACAAAAGGTAAAGTAATTCTGTCCAGACGGAATCGC
3.2 p1	A	12	c.3.2.1.12		CATATTTGAATCATAATTACTAAATATATTTTAGTTAATTTC
3.2 p1	B	01	c.3.2.1.13		ATCTTCTAGGTCTGAGAGACTACCTTTTTAACCTCTTTCCCT
3.2 p1	B	02	c.3.2.1.14		TAGAATCCAGAAATAAAGAAATTGCGTAGATTTTCCTGATTA
3.2 p1	B	03	c.3.2.1.15		TCAAACCACCGAACGAACCACCAGCAGAAGATAAAAAGAACT
3.2 p1	B	04	c.3.2.1.16		CAAACTATCGGCCTTGCTGGTAGTGTTTTTATAATCAGTGAG
3.2 p1	B	05	c.3.2.1.17		GCCACCGAAATCGGAACCCTAAAGGGAGCCCCCGAAACGTGG
3.2 p1	B	06	c.3.2.1.18		ACTCCAACGTCAAAGGGCGAAGGGAAACCTGTCGTGCCAGCT
3.2 p1	B	07	c.3.2.1.19		GCATTAAACAATTCCACACAACATACGAGCCGGAACTGTTGG
3.2 p1	B	08	c.3.2.1.20		GAAGGGCGATCGGTGCGGGCCGGGACGACGACAGTAAGGTGG
3.2 p1	B	09	c.3.2.1.21		CATCAATTCTACTAATAGTAGCGGTGTCTGGAAGTTTCATTC
3.2 p1	B	10	c.3.2.1.22		CATATAAAATTGCTGAATATATCGCGTTTTAATTCCTATTAT
3.2 p1	B	11	c.3.2.1.23		TGGATAGCGATAAAAACCAAAGGTAGAAAGATTCATACCAGT
3.2 p1	B	12	c.3.2.1.24		CAGGACGTTGGGAAGAAAAATATTTGTATCATCGCCCCAGCG
3.2 p1	C	01	c.3.2.1.25		GGCGGATACTCCTCAAGAGAAACCGGAACCGCCTCCCATCTT
3.2 p1	C	02	c.3.2.1.26		TTCATAAATATAAAAGAAACGTGTTAGCAAACGTACATATTA
3.2 p1	C	03	c.3.2.1.27		CCGTGCATCTGCCAGTTTGAGTCTTCGCTATTACGATTGTTA
3.2 p1	C	04	c.3.2.1.28		TCCGCTCTGAATCGGCCAACGGTCCACTATTAAAGTTTAGAG
3.2 p1	C	05	c.3.2.1.29		CTTGACGCCAGAATCCTGAGAAATATCCAGAACAATCGCCAT
3.2 p1	C	06	c.3.2.1.30		TAAAAATCTCAATCAATATCTTTATCATCATATTCAGGTTTA
3.2 p1	C	07	c.3.2.1.31		ACGTCAGCTTCTGTAAATCGTCGCTATTAATTAATCGGCTTA
3.2 p1	C	08	c.3.2.1.32		GGTTGGGGAGAAAACTTTTTCAGAAAAAGCCTGTTTAGTATC
3.2 p1	C	09	c.3.2.1.33		ATATGCGCCAACGCTCAACAGTAGGGCTTAATTGAACGACAA
3.2 p1	C	10	c.3.2.1.34		TAAACAACAAGAAAAATAATAGCCGTTTTTATTTTCATCGTA
3.2 p1	C	11	c.3.2.1.35		GGAATCAAGATATAGAAGGCTTATCCGGTATTCTAAACGCTA
3.2 p1	C	12	c.3.2.1.36		ACGAGCGCAATCCAAATAAGAAACGATTTTTTGTTCATGATT
3.2 p1	D	01	c.3.2.1.37		AAGACTCCTTATTACGCAGTACAAAGACACCACGGAATAAGT
3.2 p1	D	02	c.3.2.1.38		TTATTTTTCGGTCATAGCCCCCTTATTAGCGTTTGCCTCAGA
3.2 p1	D	03	c.3.2.1.39		GCCGCCACCCTCAGAACCGCCTGAAACATGAAAGTATTAAGA
3.2 p1	D	04	c.3.2.1.40		GGCTGAGAAGTGCCGTCGAGAGGGTTGATATAAGTGCGGAGT
3.2 p1	D	05	c.3.2.1.41		GAGAATAGAAAGGAACAACTACAAAAGGAGCCTTTAATTGTA
3.2 p1	D	06	c.3.2.1.42		TCGGTTTGAATACACTAAAACACTCATCTTTGACCCTGATAA
3.2 p1	D	07	c.3.2.1.43		ATTGTGTCGAAATCCGCGACCGAACTGGCTCATTATCAGTTG
3.2 p1	D	08	c.3.2.1.44		AGATTTAGGAATACCACATTCACTATCATAACCCTCGTTTAC
3.2 p1	D	09	c.3.2.1.45		CAGACGACGTCCAATACTGCGGGTCTTTACCCTGAGAGCTTC
3.2 p1	D	10	c.3.2.1.46		AAAGCGAACCAGACCGGAAGCGGTCATTTTTGCGGATGGCTT
3.2 p1	D	11	c.3.2.1.47		AGAGCTTCAGTTGATTCCCAAGGGCGCGAGCTGAAATCGGCC
3.2 p1	D	12	c.3.2.1.48		TCAGGAAGATCGCACTCCAGCTTCAGGCTGCGCAAGCATAAA
3.2 p1	E	01	c.3.2.1.49		GTGTAAACCCGCTTTCCAGTCAAACCGTCTATCAGTGCCGTA
3.2 p1	E	02	c.3.2.1.50		TGAGGCGAAAATCTAAAGCATATATAATCCTGATTATTTGCA
3.2 p1	E	03	c.3.2.1.51		CGTAAAACTTGAAAACATAGCGATAGCTTAGATTATTTATCA
3.2 p1	E	04	c.3.2.1.52		AAATCATGACCTAAATTTAATATAAGGCGTTAAATAAGAATA
3.2 p1	E	05	c.3.2.1.53		AACACCGAACAACGCCAACATGTAATTTAGGCAGAATATAAA
3.2 p1	E	06	c.3.2.1.54		GTACCGAACCAATCAATAATCACGGGTATTAAACCAAGTACC
3.2 p1	E	07	c.3.2.1.55		GCACTCATTTAGCGAACCTCCCGACTTGCGGGAGGTGCTATT
3.2 p1	E	08	c.3.2.1.56		TTGCACCAAAATAGCAGCCTTTACAGAG
3.2 p1	E	09	c.3.2.1.57		ATGGTCACGCTTCT
3.2 p1	E	10	c.3.2.1.58		TAATTGCCATTAGA
3.2 p1	E	11	c.3.2.1.59		AAGCCCGAAAGACTTCAAATAATGCTGTAGCTCAACATGTTT
3.2 p1	E	12	c.3.2.1.60		TTCAGAACAGGATT
3.2 p1	F	01	c.3.2.1.61		AGAGGGGCATCAAA
3.2 p1	F	02	c.3.2.1.62		ACGAGGCCCTCAAA
3.2 p1	F	03	c.3.2.1.63		TAACGGAACAACATTATTACAATAGCGAGAGGCTTTTGCAAA
3.2 p1	F	04	c.3.2.1.64		CTTTAATCATAACG
3.2 p1	F	05	c.3.2.1.65		AACGGAGCTACGTT
3.2 p1	F	06	c.3.2.1.66		TACGAAGGCACCAACCTAAAATAGCCGGAACGAGGCGCAGAC
3.2 p1	F	07	c.3.2.1.67		AAATCTCCAAGCGC
3.2 p1	F	08	c.3.2.1.68		TATGGGATTTTGCTAAACAACGAGGTGAATTTCTTAAACAGC
3.2 p1	F	09	c.3.2.1.69		TTTGCTCAATAATT
3.2 p1	F	10	c.3.2.1.70		TTAATGCCCCCTGCCTATTTCGTGTATCACCGTACTCAGGAG
3.2 p1	F	11	c.3.2.1.71		AGCCACCGGATTAG
3.2 p1	F	12	c.3.2.1.72		TAGCGTCAGACTGTAGCGCGTCACCCTCAGAGCCGCCACCAG
3.2 p1	G	01	c.3.2.1.73		TGGCAACTCAAAAT
3.2 p1	G	02	c.3.2.1.74		AAACGCAATAATAACGGAATAAAAATTCATATGGTTTACCAG
3.2 p1	G	03	c.3.2.1.75		AAACAGCGAAAATA
3.2 p1	G	04	c.3.2.1.76		GATTAGTTTTTGAA
3.2 p1	G	05	c.3.2.1.77		GCAAATCTTACCGC
3.2 p1	G	06	c.3.2.1.78		TCCAAGAGGCTGTC
3.2 p1	G	07	c.3.2.1.79		CAACAATAGATAAGTCCTGAACATGTTCAGCTAATGCAGAAC
3.2 p1	G	08	c.3.2.1.80		TAAGAGAGGCATTT
3.2 p1	G	09	c.3.2.1.81		TATAAAGTTATACA
3.2 p1	G	10	c.3.2.1.82		GTGATAAGGTTTGA
3.2 p1	G	11	c.3.2.1.83		CAATCGCAAGACAAAGAACGCTTATATAACTATATGTAAATG
3.2 p1	G	12	c.3.2.1.84		TAGTGAAAGACGCT
3.2 p1	H	01	c.3.2.1.85		AACCTTGATGAATA
3.2 p1	H	02	c.3.2.1.86		AGAACCTACCATATCAAAATTGTTTGGATTATACTTCTGAAT
3.2 p1	H	03	c.3.2.1.87		AGCGGAAGGTCAGT
3.2 p1	H	04	c.3.2.1.88		CTGAGAGCCAGCAGCAAATGAGTCAGTATTAACACCGCCTGC
3.2 p1	H	05	c.3.2.1.89		TAAAACATATTACC
3.2 p1	H	06	c.3.2.1.90		CGGTACGGGGAAAG
3.2 p1	H	07	c.3.2.1.91		TCAAGTTTTTTGGGGTCGAGGGGCGATGGCCCACTACGTGAA
3.2 p1	H	08	c.3.2.1.92		AACAAGACGCGGGG
3.2 p1	H	09	c.3.2.1.93		TTAATTGCGTTGCGCTCACTGGCCTGGGGTGCCTAATGAGTG
3.2 p1	H	10	c.3.2.1.94		GTGTGAACCAGCTG
3.2 p1	H	11			*****
3.2 p1	H	12			*****
3.2 p2	A	01	c3.2.2.1		CGAACTGTGGGCTT
3.2 p2	A	02	c3.2.2.2		TTGAAAGAGGAAGTTTCCATTTGACAACAACCATCTTTTGTC
3.2 p2	A	03	c3.2.2.3		GTCTTTCGCCACCCTCAGAACCGGGGTCAGTGCCTATTGACA
3.2 p2	A	04	c3.2.2.4		GGAGGTTCAGCACCGTAATCAAACCGATTGAGGGAAGCAGAT
3.2 p2	A	05	c3.2.2.5		AGCCGAACATTAGACGGGAGAATTAACTGAACACCCTGAACA
3.2 p2	A	06	c3.2.2.6		AAGTCAGCTTACCGAAGCCCTTTTTAAGAAAAGTAGGGAAGG
3.2 p2	A	07	c3.2.2.7		TAAATATTGACGGAAATTATTGAAACGTCACCAATGAAACCA
3.2 p2	A	08	c3.2.2.8		TCGATAGGAGGCAGGTCAGACGATTGGCCTTGATAACAGGAG
3.2 p2	A	09	c3.2.2.9		TGTACTGGTAATAAGTTTTAACGCCACCCTCAGAGCCACCAC
3.2 p2	A	10	c3.2.2.10		CCTCATTCCCTCATAGTTAGCGTAACGATCTAAAGGCCCACG
3.2 p2	A	11	c3.2.2.11		CATAACCGATATATTCGGTCGGGCTTTGAGGACTAAAGACTT
3.2 p2	A	12	c3.2.2.12		TTTCATGAGGACAGATGAACGGTGTACAGACCAGGTAAGGCT
3.2 p2	B	01	c3.2.2.13		TGCCCTGACGAGAAACACCAGAACGAGTAGTAAATACCAACT
3.2 p2	B	02	c3.2.2.14		CCAAATCAACGTAACAAAGCTGCTCATTCAGTGAACGCATAG
3.2 p2	B	03	c3.2.2.15		GCTGGCTGCAACGGCTACAGACTGAGGCTTGCAGGCATTCCA
3.2 p2	B	04	c3.2.2.16		CAGACAGTTCAGGGATAGCAATGGCTTTTGATGATTTCACAA
3.2 p2	B	05	c3.2.2.17		ACAAATACATTAGCAAGGCCGCATTAAAGGTGAATATAGCAA
3.2 p2	B	06	c3.2.2.18		TAGCTATAGGGTAATTGAGCGCTAATATCAGAGAGATAACCC
3.2 p2	B	07	c3.2.2.19		GACAGCATCGGAACGAGGGTAGACCTTCATCAAGAGTAATCT
3.2 p2	B	08	c3.2.2.20		CCGACAAAAACGGG
3.2 p2	B	09	c3.2.2.21		TACAAACTACAACGCCTGTAGGAGTTAAAGGCCGCTTTTGCG
3.2 p2	B	10	c3.2.2.22		CAGAACCCAGACGT
3.2 p2	B	11	c3.2.2.23		CGTTCCAGTAAGCGTCATACAGCCCAATAGGAACCCATGTAC
3.2 p2	B	12	c3.2.2.24		CGCCAGCTGAGTAA
3.2 p2	C	01	c3.2.2.25		AATCACCAGTAGCACCATTACAATCCTCATTAAAGCCAGAAT
3.2 p2	C	02	c3.2.2.26		GACATTCGTAGCGA
3.2 p2	C	03	c3.2.2.27		ATAAGAGCAAGAAACAATGAATATCACCGTCACCGACTTGAG
3.2 p2	C	04	c3.2.2.28		GGAAGCGCAAAGTT
3.2 p2	C	05	c3.2.3.1		ATGGTCAATAACCTGTTTAGCTATATTTTCATTTGGGGCGCG
3.2 p2	C	06	c3.2.3.2		AGCTGAAAAGGTGGCATCAATTCTACTAATAGTAGTAGCATT
3.2 p2	C	07	c3.2.3.3		TGAAACATCATTTC
3.2 p2	C	08	c3.2.3.4		AGAAAACAAAATTAATTACATTTAACAATTTCATTGCTTTGA
3.2 p2	C	09	c3.2.3.5		ATACCAAGTTACAAAATCGCGTAAATCCTTTGCCCGAACGTT
3.2 p2	C	10	c3.2.3.6		ATTAATTGAGCACTAACAACTAATAGATTAGAGCCCTGACCT
3.2 p2	C	11	c3.2.3.7		GAAAGCGTAAGAATACGTGGCCAATCGTCTGAAATGGATTAT
3.2 p2	C	12	c3.2.3.8		TTACATTGAGCACGTATAACGTGCTTTCCTCGTTAGGCGCTG
3.2 p2	D	01	c3.2.3.9		GCAAGTGTAGCGGTCACGCTGGATGGTGGTTCCGAAATCGGC
3.2 p2	D	02	c3.2.3.10		AAAATCCCGGGCAACAGCTGATTGCCCTTCACCGCCCGTATA
3.2 p2	D	03	c3.2.3.11		CGCATGGCTAGTACCCGTATACCAGTCACGACGTTGTAAAAC
3.2 p2	D	04	c3.2.3.12		GACGGCCAGTGCCAAGCTTGCAAGTCCGCTAGCGACTGGCCC
3.2 p2	D	05	c3.2.3.13		TGAGAGACGAAAATCCTGTTTCGCGTAACCACCACATGGTTG
3.2 p2	D	06	c3.2.3.14		CTTTGACGGCAGATTCACCAGGAGATAGAACCCTTGTCAATA
3.2 p2	D	07	c3.2.3.15		GATAATATCGACAACTCGTATCAGAGGCGAATTATAACATCA
3.2 p2	D	08	c3.2.3.16		GCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCAGGATCC
3.2 p2	D	09	c3.2.3.17		CCGGGTATTTCACCAGTGAGACTTATAAATCAAAAGGAGCGG
3.2 p2	D	10	c3.2.3.18		GCGCTAGGAATCAGAGCGGGATACATTTTGACGCTACAGACA
3.2 p2	D	11	c3.2.3.19		ATATTTTTAAAATATCTTTAGTTAAAAGTTTGAGTGGATTCG
3.2 p2	D	12	c3.2.3.20		CCTGATTTGAATTACCTTTTTTAATGGAAACAGTACATAAAT
3.2 p2	E	01	c3.2.3.21		TACATCGGGAGAAACAATAACAACATTATCATTTTGCGGAAC
3.2 p2	E	02	c3.2.3.22		AAACAATCATTTGA
3.2 p2	E	03	c3.2.3.23		AAGGAATTGAGGAAGGTTATCTGAATGGCTATTAGTCTTTAA
3.2 p2	E	04	c3.2.3.24		GCCAACATCACACG
3.2 p2	E	05	c3.2.3.25		AAAAACGCTCATGGAAATACCGCTAAACAGGAGGCCGATTAA
3.2 p2	E	06	c3.2.3.26		GCGTACTACCCGCC
3.2 p2	E	07	c3.2.3.27		AAGGAAGGGAAGAAAGCGAAAGAATAGCCCGAGATAGGGTTG
3.2 p2	E	08	c3.2.3.28		CAGCAGGGTTGCAG
3.2 p2	E	09	c3.2.3.29		GGGCGCCAGGGTGGTTTTTCTCCGAGCTCGAATTCGTAATCA
3.2 p2	E	10	c3.2.3.30		GCGAGGCATGCCTG
3.2 p2	E	11	c3.2.4.1		GGAATAGGGAACCTATTATTCACCCTCAGAGCCACTTTCATC
3.2 p2	E	12	c3.2.4.2		AAGCACTAGTAAAAGAGTCTGACTTGCCTGAGTAGACAGAGG
3.2 p2	F	01	c3.2.4.3		AGTCAGAAGCAAAGCGGATTGGTAATAGTAAAATGTTTAGAC
3.2 p2	F	02	c3.2.5.1		GGCAAAAATCAGCTTGCTTTCTTTCAACAGTTTCAATAGCCC
3.2 p2	F	03	c3.2.5.2		TCAGATGATGGCAATTCATCACACCTTGCTGAACCTCAAATA
3.2 p2	F	04	c3.2.5.3		TTTATCCTCTTTCCAGAGCCTAATTTGC
3.2 p2	F	05	c3.2.6.1		GGAATAGGGAACCTATTATTCACCCTCAGAGCCACTTTCATCTTTGGTTGGTGTGGTTGG
3.2 p2	F	06	c3.2.6.2		AAGCACTAGTAAAAGAGTCTGACTTGCCTGAGTAGACAGAGGTTTGGTTGGTGTGGTTGG
3.2 p2	F	07	c3.2.6.3		AGTCAGAAGCAAAGCGGATTGGTAATAGTAAAATGTTTGGTTGGTGTGGTTGG
3.2 p2	F	08	c3.2.7.1		GGCAAAAATCAGCTTGCTTTCTTTCAACAGTTTCAATAGCCCTTTGGTTGGTGTGGTTGG
3.2 p2	F	09	c3.2.7.2		TCAGATGATGGCAATTCATCACACCTTGCTGAACCTTTGGTTGGTGTGGTTGG
3.2 p2	F	10	c3.2.7.3		TTTATCCTCTTTCCAGAGCCTTTTGGTTGGTGTGGTTGG
3.2 p2	F	11	c3.2.8.1		TCTTTGATTAGTAATAACATCTCCATCACGCAAATTAACCGT
3.2 p2	F	12	c3.2.8.2		ATTATACCAAAAAAAAGGCTCAAGGAATTGCGAATAGTACCA
3.2 p2	G	01	c3.2.10.1		TAATAACATCTCCATCACGCAAATTAACCGT
3.2 p2	G	02	c3.2.10.2		ATTATACCAAAAAAAAGGCTCAAGGAAT
3.2 p2	G	03	c3.2.11.1		TCTTTGATTAGTTTTCTGGTTGATTCTAATAGATGTGGCAA
3.2 p2	G	04	c3.2.11.2		TGCGAATAGTACCATTTTGTGATACTACGTCTGAGAAGATGTGC
3.2 p2	G	05	c3.2.12.1		TCTTTGATTAGTTTTTCTATCCTTCACGA
3.2 p2	G	06	c3.2.12.2		TGCGAATAGTACCATTTTATAGATATGCAGGA
3.2 p2	G	07	c3.2.14.1		GGAAAGCGCAGTTTTTTTAGAATCAACCAGATCGGTATGGCA
3.2 p2	G	08	c3.2.14.2		GCGCTTAATGCGTTTTAGACGTAGTATCACATGCTCCACCCG
3.2 p2	G	09	c3.2.15.1		GGAAAGCGCAGTTTTTTTAGAATCAACCAG
3.2 p2	G	10	c3.2.15.2		GCGCTTAATGCGTTTTAGACGTAGTATCAC
3.2 p2	G	11	c3.2.16.1		TCGTGAAATTCTAATGGCCCCAATAC
3.2 p2	G	12	c3.2.16.2		CTGGTTGGGATAGAGAGCTGTTCACC
3.2 p2	H	01	c3.2.16.3		TCCTGCATACGTCTATGCTCCACCCG
3.2 p2	H	02	c3.2.16.4		GTGATACTATCTATGAGAAGATGTGC
3.2 p2	H	03	c3.2.17.1		TGCCATACCGATCTGGTTGATTCTAAAAAAACTGCGCTTTCC
3.2 p2	H	04	c3.2.17.2		TTGCCACATCTATTAGAATCAACCAGAAAACTAATCAAAGA
3.2 p2	H	05	c3.2.17.3		CGGGTGGAGCATGTGATACTACGTCTAAAACGCATTAAGCGC
3.2 p2	H	06	c3.2.17.4		GCACATCTTCTCAGACGTAGTATCACAAAATGGTACTATTCGCA
3.2 p2	H	07	c3.2.18.1		GTATTGGGGCCATTAGAATTTCACGA
3.2 p2	H	08	c3.2.18.2		GGTGAACAGCTCTCTATCCCAACCAG
3.2 p2	H	09	c3.2.18.3		CGGGTGGAGCATAGACGTATGCAGGA
3.2 p2	H	10	c3.2.18.4		GCACATCTTCTCATAGATAGTATCAC
3.2 p2	H	11			*****
3.2 p2	H	12			*****
Oligo order list, container 3.2

* all sequences are 5' to 3'
* subsection key is below

***************************************************

** c3.2.1: core barrel oligos
** c3.2.2: core top lid oligos
** c3.2.3: core bottom lid oligos
** c3.2.4: barrel oligos at inside apatamer locations -aptamers
** c3.2.5: barrel oligos at outside aptamer locations -aptamers
** c3.2.6: barrel oligos at inside apatamer locations +aptamers
** c3.2.7: barrel oligos at outside aptamer locations +aptamers
** c3.2.8: barrel oligos at latch locations -latches
** c3.2.9: lid oligos at latch locations -latches
** c3.2.10: barrel oligos at latch locations +latch1 +latch2
** c3.2.11: latch oligos from barrel +latch1 -latch2
** c3.2.12: latch oligos from barrel -latch1 +latch2
** c3.2.13: lid oligos at latch locations +latch1 +latch2
** c3.2.14: latch oligos from lids +latch1 -latch2
** c3.2.15: latch oligos from lids -latch1 +latch2
** c3.2.16: latch staples +latch2
** c3.2.17: displacement strands: latch1
** c3.2.18: displacement strands: latch2

***************************************************

c.3.2.1

 0  001 00  000 00  
    TAAAGTA TAGCATT 

 1  040 11  040 10  040 09  041 09  041 10  000 10  
    CAGGCAA AGCGCCA TTCGCCA CAGCTTT CCGGCAC ATAACCT 

    000 09  000 08  000 07  001 07  001 08  001 09  
    GTTTAGC TATATTT TCATTTG TTCTGCG AACGAGT AGATTTA 

    001 10  002 10  002 09  003 09  003 10  004 10  
    GTTTGAC TCCTTTT GATAAGA AAACTCC AACAGGT AACGAGA 

    004 09  004 08  004 07  005 07  005 08  005 09  
    ATGACCA TAAATCA AAAATCA GAATCGT CATAAAT ATTCATT 

    005 10  006 10  006 09  007 09  007 10  008 10  
    GAATCCC ATAGTAA GAGCAAC AACTAAT GCAGATA CATTGTG 

    008 09  008 08  008 07  009 07  009 08  010 08  
    AATTACC TTATGCG ATTTTAA TGCTCCA TGTTACT CGAAAGA 

    016 07  017 07  017 08  018 08  018 07  019 07  
    GGCATTT GTCACAA TCAATAG CCCAAAA GAACTGG TAACGTC 

    019 08  020 08  020 07  020 06  020 05  021 05  
    AAAAATG CAGCTAC AATTTTA TCCTGAA TCTTACC AGAACGC 

    021 06  022 06  022 05  023 05  023 06  023 07  
    GAGGCGT TCGAGAA CAAGCAA TCCCATC CTAATTT ACGAGCA 

    023 08  024 08  024 07  024 06  024 05  025 05  
    TGTAGAA CAAAAGG TAAAGTA ATTCTGT CCAGACG GAATCGC 

    025 06  026 06  026 05  027 05  027 06  027 07  
    CATATTT GAATCAT AATTACT AAATATA TTTTAGT TAATTTC 

    027 08  028 08  028 07  028 06  028 05  029 05  
    ATCTTCT AGGTCTG AGAGACT ACCTTTT TAACCTC TTTCCCT 

    029 06  030 06  030 05  030 04  030 03  031 03  
    TAGAATC CAGAAAT AAAGAAA TTGCGTA GATTTTC CTGATTA 

    032 03  033 03  033 04  033 05  033 06  034 06  
    TCAAACC ACCGAAC GAACCAC CAGCAGA AGATAAA AAGAACT 

    034 05  034 04  034 03  035 03  035 04  035 05  
    CAAACTA TCGGCCT TGCTGGT AGTGTTT TTATAAT CAGTGAG 

    035 06  036 06  036 05  036 04  036 03  037 03  
    GCCACCG AAATCGG AACCCTA AAGGGAG CCCCCGA AACGTGG 

    037 04  037 05  037 06  038 06  038 05  038 04  
    ACTCCAA CGTCAAA GGGCGAA GGGAAAC CTGTCGT GCCAGCT 

    038 03  039 03  039 04  039 05  039 06  040 06  
    GCATTAA ACAATTC CACACAA CATACGA GCCGGAA CTGTTGG 

    040 05  040 04  040 03  041 03  041 04  000 04  
    GAAGGGC GATCGGT GCGGGCC GGGACGA CGACAGT AAGGTGG 

    000 03  000 02  000 01  001 01  001 02  001 03  
    CATCAAT TCTACTA ATAGTAG CGGTGTC TGGAAGT TTCATTC 

    001 04  002 04  002 03  003 03  003 04  004 04  
    CATATAA AATTGCT GAATATA TCGCGTT TTAATTC CTATTAT 

    005 04  006 04  006 03  007 03  007 04  008 04  
    TGGATAG CGATAAA AACCAAA GGTAGAA AGATTCA TACCAGT 

    008 03  008 02  008 01  009 01  009 02  010 02  
    CAGGACG TTGGGAA GAAAAAT ATTTGTA TCATCGC CCCAGCG 

    013 02  014 02  014 01  015 01  015 02  016 02  
    GGCGGAT ACTCCTC AAGAGAA ACCGGAA CCGCCTC CCATCTT 

    016 01  017 01  017 02  018 02  018 01  019 01  
    TTCATAA ATATAAA AGAAACG TGTTAGC AAACGTA CATATTA 

 2  041 00  041 01  041 02  040 02  040 01  039 01  
    CCGTGCA TCTGCCA GTTTGAG TCTTCGC TATTACG ATTGTTA 

    039 02  038 02  038 01  037 01  037 02  036 02  
    TCCGCTC TGAATCG GCCAACG GTCCACT ATTAAAG TTTAGAG 

    036 01  035 01  035 02  034 02  034 01  033 01  
    CTTGACG CCAGAAT CCTGAGA AATATCC AGAACAA TCGCCAT 

    033 02  032 02  032 01  031 01  031 02  030 02  
    TAAAAAT CTCAATC AATATCT TTATCAT CATATTC AGGTTTA 

    030 01  029 01  029 02  029 03  029 04  028 04  
    ACGTCAG CTTCTGT AAATCGT CGCTATT AATTAAT CGGCTTA 

    028 03  027 03  027 04  026 04  026 03  026 02  
    GGTTGGG GAGAAAA CTTTTTC AGAAAAA GCCTGTT TAGTATC 

    026 01  025 01  025 02  025 03  025 04  024 04  
    ATATGCG CCAACGC TCAACAG TAGGGCT TAATTGA ACGACAA 

    024 03  023 03  023 04  022 04  022 03  022 02  
    TAAACAA CAAGAAA AATAATA GCCGTTT TTATTTT CATCGTA 

    022 01  021 01  021 02  021 03  021 04  020 04  
    GGAATCA AGATATA GAAGGCT TATCCGG TATTCTA AACGCTA 

    020 03  019 03  019 04  019 05  019 06  018 06  
    ACGAGCG CAATCCA AATAAGA AACGATT TTTTGTT CATGATT 

    018 05  018 04  018 03  017 03  017 04  017 05  
    AAGACTC CTTATTA CGCAGTA CAAAGAC ACCACGG AATAAGT 

    017 06  016 06  016 05  016 04  016 03  015 03  
    TTATTTT TCGGTCA TAGCCCC CTTATTA GCGTTTG CCTCAGA 

    015 04  015 05  015 06  014 06  014 05  014 04  
    GCCGCCA CCCTCAG AACCGCC TGAAACA TGAAAGT ATTAAGA 

    014 03  013 03  013 04  013 05  013 06  012 06  
    GGCTGAG AAGTGCC GTCGAGA GGGTTGA TATAAGT GCGGAGT 

    012 05  012 04  012 03  011 03  011 04  011 05  
    GAGAATA GAAAGGA ACAACTA CAAAAGG AGCCTTT AATTGTA 

    011 06  010 06  010 05  010 04  010 03  009 03  
    TCGGTTT GAATACA CTAAAAC ACTCATC TTTGACC CTGATAA 

    009 04  009 05  009 06  008 06  008 05  007 05  
    ATTGTGT CGAAATC CGCGACC GAACTGG CTCATTA TCAGTTG 

    007 06  007 07  007 08  006 08  006 07  006 06  
    AGATTTA GGAATAC CACATTC ACTATCA TAACCCT CGTTTAC 

    006 05  005 05  005 06  004 06  004 05  003 05  
    CAGACGA CGTCCAA TACTGCG GGTCTTT ACCCTGA GAGCTTC 

    003 06  003 07  003 08  002 08  002 07  002 06  
    AAAGCGA ACCAGAC CGGAAGC GGTCATT TTTGCGG ATGGCTT 

    002 05  001 05  001 06  000 06  000 05  041 05  
    AGAGCTT CAGTTGA TTCCCAA GGGCGCG AGCTGAA ATCGGCC 

    041 06  041 07  041 08  040 08  040 07  039 07  
    TCAGGAA GATCGCA CTCCAGC TTCAGGC TGCGCAA GCATAAA 

    039 08  038 08  038 07  037 07  037 08  036 08  
    GTGTAAA CCCGCTT TCCAGTC AAACCGT CTATCAG TGCCGTA 

    033 08  032 08  032 07  031 07  031 08  030 08  
    TGAGGCG AAAATCT AAAGCAT ATATAAT CCTGATT ATTTGCA 

    030 07  029 07  029 08  029 09  029 10  028 10  
    CGTAAAA CTTGAAA ACATAGC GATAGCT TAGATTA TTTATCA 

    028 09  027 09  027 10  026 10  026 09  026 08  
    AAATCAT GACCTAA ATTTAAT ATAAGGC GTTAAAT AAGAATA 

    026 07  025 07  025 08  025 09  025 10  024 10  
    AACACCG AACAACG CCAACAT GTAATTT AGGCAGA ATATAAA 

    024 09  023 09  023 10  022 10  022 09  022 08  
    GTACCGA ACCAATC AATAATC ACGGGTA TTAAACC AAGTACC 

    022 07  021 07  021 08  021 09  021 10  020 10  
    GCACTCA TTTAGCG AACCTCC CGACTTG CGGGAGG TGCTATT 

    020 09  019 09  019 10  019 11  
    TTGCACC AAAATAG CAGCCTT TACAGAG 

 3  000 11  041 11  
    ATGGTCA CGCTTCT 

 4  002 11  001 11  
    TAATTGC CATTAGA 

 5  003 00  003 01  003 02  002 02  002 01  002 00  
    AAGCCCG AAAGACT TCAAATA ATGCTGT AGCTCAA CATGTTT 

 6  004 11  003 11  
    TTCAGAA CAGGATT 

 7  005 00  004 00  
    AGAGGGG CATCAAA 

 8  006 11  005 11  
    ACGAGGC CCTCAAA 

 9  007 00  007 01  007 02  006 02  006 01  006 00  
    TAACGGA ACAACAT TATTACA ATAGCGA GAGGCTT TTGCAAA 

10  008 11  007 11  
    CTTTAAT CATAACG 

11  009 00  008 00  
    AACGGAG CTACGTT 

12  010 11  010 10  010 09  009 09  009 10  009 11  
    TACGAAG GCACCAA CCTAAAA TAGCCGG AACGAGG CGCAGAC 

13  011 00  010 00  
    AAATCTC CAAGCGC 

14  012 11  012 10  012 09  011 09  011 10  011 11  
    TATGGGA TTTTGCT AAACAAC GAGGTGA ATTTCTT AAACAGC 

15  013 00  012 00  
    TTTGCTC AATAATT 

16  014 11  014 10  014 09  013 09  013 10  013 11  
    TTAATGC CCCCTGC CTATTTC GTGTATC ACCGTAC TCAGGAG 

17  015 00  014 00  
    AGCCACC GGATTAG 

18  016 11  016 10  016 09  015 09  015 10  015 11  
    TAGCGTC AGACTGT AGCGCGT CACCCTC AGAGCCG CCACCAG 

19  017 00  016 00  
    TGGCAAC TCAAAAT 

20  018 11  018 10  018 09  017 09  017 10  017 11  
    AAACGCA ATAATAA CGGAATA AAAATTC ATATGGT TTACCAG 

21  019 00  018 00  
    AAACAGC GAAAATA 

22  020 11  021 11  
    GATTAGT TTTTGAA 

23  021 00  022 00  
    GCAAATC TTACCGC 

24  022 11  023 11  
    TCCAAGA GGCTGTC 

25  023 00  023 01  023 02  024 02  024 01  024 00  
    CAACAAT AGATAAG TCCTGAA CATGTTC AGCTAAT GCAGAAC 

26  024 11  025 11  
    TAAGAGA GGCATTT 

27  025 00  026 00  
    TATAAAG TTATACA 

28  026 11  027 11  
    GTGATAA GGTTTGA 

29  027 00  027 01  027 02  028 02  028 01  028 00  
    CAATCGC AAGACAA AGAACGC TTATATA ACTATAT GTAAATG 

30  028 11  029 11  
    TAGTGAA AGACGCT 

31  029 00  030 00  
    AACCTTG ATGAATA 

32  030 11  030 10  030 09  031 09  031 10  031 11  
    AGAACCT ACCATAT CAAAATT GTTTGGA TTATACT TCTGAAT 

33  031 00  032 00  
    AGCGGAA GGTCAGT 

34  032 11  032 10  032 09  033 09  033 10  033 11  
    CTGAGAG CCAGCAG CAAATGA GTCAGTA TTAACAC CGCCTGC 

35  033 00  034 00  
    TAAAACA TATTACC 

37  035 00  036 00  
    CGGTACG GGGAAAG 

38  036 11  036 10  036 09  037 09  037 10  037 11  
    TCAAGTT TTTTGGG GTCGAGG GGCGATG GCCCACT ACGTGAA 

39  037 00  038 00  
    AACAAGA CGCGGGG 

40  038 11  038 10  038 09  039 09  039 10  039 11  
    TTAATTG CGTTGCG CTCACTG GCCTGGG GTGCCTA ATGAGTG 

41  039 00  040 00  
    GTGTGAA CCAGCTG 

***************************************************

c3.2.2

 0  001 00  000 00  
    CGAACTG TGGGCTT 

 1  001 02  002 02  002 01  003 01  003 02  004 02  
    TTGAAAG AGGAAGT TTCCATT TGACAAC AACCATC TTTTGTC 

    004 01  005 01  005 02  006 02  006 01  007 01  
    GTCTTTC GCCACCC TCAGAAC CGGGGTC AGTGCCT ATTGACA 

    007 02  008 02  008 01  009 01  009 02  010 02  
    GGAGGTT CAGCACC GTAATCA AACCGAT TGAGGGA AGCAGAT 

    010 01  011 01  011 02  011 03  011 04  011 05  
    AGCCGAA CATTAGA CGGGAGA ATTAACT GAACACC CTGAACA 

    011 06  010 06  010 05  010 04  010 03  009 03  
    AAGTCAG CTTACCG AAGCCCT TTTTAAG AAAAGTA GGGAAGG 

    009 04  009 05  009 06  008 06  008 05  008 04  
    TAAATAT TGACGGA AATTATT GAAACGT CACCAAT GAAACCA 

    008 03  007 03  007 04  007 05  007 06  006 06  
    TCGATAG GAGGCAG GTCAGAC GATTGGC CTTGATA ACAGGAG 

    006 05  006 04  006 03  005 03  005 04  005 05  
    TGTACTG GTAATAA GTTTTAA CGCCACC CTCAGAG CCACCAC 

    005 06  004 06  004 05  004 04  004 03  003 03  
    CCTCATT CCCTCAT AGTTAGC GTAACGA TCTAAAG GCCCACG 

    003 04  003 05  003 06  002 06  002 05  002 04  
    CATAACC GATATAT TCGGTCG GGCTTTG AGGACTA AAGACTT 

    002 03  001 03  001 04  001 05  001 06  000 06  
    TTTCATG AGGACAG ATGAACG GTGTACA GACCAGG TAAGGCT 

    000 05  000 04  000 03  000 02  000 01  001 01  
    TGCCCTG ACGAGAA ACACCAG AACGAGT AGTAAAT ACCAACT 

 2  000 11  000 10  000 09  000 08  000 07  001 07  
    CCAAATC AACGTAA CAAAGCT GCTCATT CAGTGAA CGCATAG 

    001 08  002 08  002 07  003 07  003 08  004 08  
    GCTGGCT GCAACGG CTACAGA CTGAGGC TTGCAGG CATTCCA 

    004 07  005 07  005 08  006 08  006 07  007 07  
    CAGACAG TTCAGGG ATAGCAA TGGCTTT TGATGAT TTCACAA 

    007 08  008 08  008 07  009 07  009 08  010 08  
    ACAAATA CATTAGC AAGGCCG CATTAAA GGTGAAT ATAGCAA 

    010 07  011 07  011 08  011 09  011 10  011 11  
    TAGCTAT AGGGTAA TTGAGCG CTAATAT CAGAGAG ATAACCC 

 3  002 11  002 10  002 09  001 09  001 10  001 11  
    GACAGCA TCGGAAC GAGGGTA GACCTTC ATCAAGA GTAATCT 

 4  003 00  002 00  
    CCGACAA AAACGGG 

 5  004 11  004 10  004 09  003 09  003 10  003 11  
    TACAAAC TACAACG CCTGTAG GAGTTAA AGGCCGC TTTTGCG 

 6  005 00  004 00  
    CAGAACC CAGACGT 

 7  006 11  006 10  006 09  005 09  005 10  005 11  
    CGTTCCA GTAAGCG TCATACA GCCCAAT AGGAACC CATGTAC 

 8  007 00  006 00  
    CGCCAGC TGAGTAA 

 9  008 11  008 10  008 09  007 09  007 10  007 11  
    AATCACC AGTAGCA CCATTAC AATCCTC ATTAAAG CCAGAAT 

10  009 00  008 00  
    GACATTC GTAGCGA 

11  010 11  010 10  010 09  009 09  009 10  009 11  
    ATAAGAG CAAGAAA CAATGAA TATCACC GTCACCG ACTTGAG 

12  011 00  010 00  
    GGAAGCG CAAAGTT 

***************************************************

c3.2.3

 0  000 11  000 10  000 09  000 08  000 07  000 06  
    ATGGTCA ATAACCT GTTTAGC TATATTT TCATTTG GGGCGCG 

    000 05  000 04  000 03  000 02  000 01  000 00  
    AGCTGAA AAGGTGG CATCAAT TCTACTA ATAGTAG TAGCATT 

 1  001 00  002 00  
    TGAAACA TCATTTC 

 2  001 02  001 03  001 04  001 05  001 06  002 06  
    AGAAAAC AAAATTA ATTACAT TTAACAA TTTCATT GCTTTGA 

    002 05  002 04  002 03  003 03  003 04  003 05  
    ATACCAA GTTACAA AATCGCG TAAATCC TTTGCCC GAACGTT 

    003 06  004 06  004 05  004 04  004 03  005 03  
    ATTAATT GAGCACT AACAACT AATAGAT TAGAGCC CTGACCT 

    005 04  005 05  005 06  006 06  006 05  006 04  
    GAAAGCG TAAGAAT ACGTGGC CAATCGT CTGAAAT GGATTAT 

    006 03  007 03  007 04  007 05  007 06  008 06  
    TTACATT GAGCACG TATAACG TGCTTTC CTCGTTA GGCGCTG 

    008 05  008 04  008 03  009 03  009 04  009 05  
    GCAAGTG TAGCGGT CACGCTG GATGGTG GTTCCGA AATCGGC 

    009 06  010 06  010 05  010 04  010 03  011 03  
    AAAATCC CGGGCAA CAGCTGA TTGCCCT TCACCGC CCGTATA 

    011 04  011 05  011 06  012 06  012 05  012 04  
    CGCATGG CTAGTAC CCGTATA CCAGTCA CGACGTT GTAAAAC 

    012 03  012 02  012 01  011 01  011 02  010 02  
    GACGGCC AGTGCCA AGCTTGC AAGTCCG CTAGCGA CTGGCCC 

    010 01  009 01  009 02  008 02  008 01  007 01  
    TGAGAGA CGAAAAT CCTGTTT CGCGTAA CCACCAC ATGGTTG 

    007 02  006 02  006 01  005 01  005 02  004 02  
    CTTTGAC GGCAGAT TCACCAG GAGATAG AACCCTT GTCAATA 

    004 01  003 01  003 02  002 02  002 01  001 01  
    GATAATA TCGACAA CTCGTAT CAGAGGC GAATTAT AACATCA 

 3  012 11  012 10  012 09  012 08  012 07  011 07  
    GCAAGGC GATTAAG TTGGGTA ACGCCAG GGTTTTC AGGATCC 

    011 08  010 08  010 07  009 07  009 08  008 08  
    CCGGGTA TTTCACC AGTGAGA CTTATAA ATCAAAA GGAGCGG 

    008 07  007 07  007 08  006 08  006 07  005 07  
    GCGCTAG GAATCAG AGCGGGA TACATTT TGACGCT ACAGACA 

    005 08  004 08  004 07  003 07  003 08  002 08  
    ATATTTT TAAAATA TCTTTAG TTAAAAG TTTGAGT GGATTCG 

    002 07  001 07  001 08  001 09  001 10  001 11  
    CCTGATT TGAATTA CCTTTTT TAATGGA AACAGTA CATAAAT 

 4  002 11  002 10  002 09  003 09  003 10  003 11  
    TACATCG GGAGAAA CAATAAC AACATTA TCATTTT GCGGAAC 

 5  003 00  004 00  
    AAACAAT CATTTGA 

 6  004 11  004 10  004 09  005 09  005 10  005 11  
    AAGGAAT TGAGGAA GGTTATC TGAATGG CTATTAG TCTTTAA 

 7  005 00  006 00  
    GCCAACA TCACACG 

 8  006 11  006 10  006 09  007 09  007 10  007 11  
    AAAAACG CTCATGG AAATACC GCTAAAC AGGAGGC CGATTAA 

 9  007 00  008 00  
    GCGTACT ACCCGCC 

10  008 11  008 10  008 09  009 09  009 10  009 11  
    AAGGAAG GGAAGAA AGCGAAA GAATAGC CCGAGAT AGGGTTG 

11  009 00  010 00  
    CAGCAGG GTTGCAG 

12  010 11  010 10  010 09  011 09  011 10  011 11  
    GGGCGCC AGGGTGG TTTTTCT CCGAGCT CGAATTC GTAATCA 

13  011 00  012 00  
    GCGAGGC ATGCCTG 

***************************************************

c3.2.4

    013 08  014 08  014 07  015 07  015 08  016 08  
    GGAATAG GGAACCT ATTATTC ACCCTCA GAGCCAC TTTCATC 

    036 07  035 07  035 08  034 08  034 07  033 07  
    AAGCACT AGTAAAA GAGTCTG ACTTGCC TGAGTAG ACAGAGG 

    004 03  004 02  004 01  005 01  005 02  005 03  
    AGTCAGA AGCAAAG CGGATTG GTAATAG TAAAATG TTTAGAC 

***************************************************

c3.2.5

    010 07  011 07  011 08  012 08  012 07  013 07  
    GGCAAAA ATCAGCT TGCTTTC TTTCAAC AGTTTCA ATAGCCC 

    031 04  031 05  031 06  032 06  032 05  032 04  
    TCAGATG ATGGCAA TTCATCA CACCTTG CTGAACC TCAAATA 

    019 02  020 02  020 01  020 00  
    TTTATCC TCTTTCC AGAGCCT AATTTGC 

***************************************************

c3.2.6

 1* 013 08  014 08  014 07  015 07  015 08  016 08  
    GGAATAG GGAACCT ATTATTC ACCCTCA GAGCCAC TTTCATC TTT GGTTGGTGTGGTTGG

 2* 036 07  035 07  035 08  034 08  034 07  033 07  
    AAGCACT AGTAAAA GAGTCTG ACTTGCC TGAGTAG ACAGAGG TTT GGTTGGTGTGGTTGG

 1* 004 03  004 02  004 01  005 01  005 02    
    AGTCAGA AGCAAAG CGGATTG GTAATAG TAAAATG TTT GGTTGGTGTGGTTGG

***************************************************

c3.2.7

 1* 010 07  011 07  011 08  012 08  012 07  013 07  
    GGCAAAA ATCAGCT TGCTTTC TTTCAAC AGTTTCA ATAGCCC TTT GGTTGGTGTGGTTGG

 1* 031 04  031 05  031 06  032 06  032 05    
    TCAGATG ATGGCAA TTCATCA CACCTTG CTGAACC TTT GGTTGGTGTGGTTGG

 1* 019 02  020 02  020 01  
    TTTATCC TCTTTCC AGAGCCT TTT GGTTGGTGTGGTTGG

***************************************************

c3.2.8

36  034 11  034 10  034 09  035 09  035 10  035 11  
    TCTTTGA TTAGTAA TAACATC TCCATCA CGCAAAT TAACCGT 

    010 01  011 01  011 02  012 02  012 01  013 01  
    ATTATAC CAAAAAA AAGGCTC AAGGAAT TGCGAAT AGTACCA 

***************************************************

c3.2.9

(none)

***************************************************

c3.2.10

36*         034 10  034 09  035 09  035 10  035 11  
                TAA TAACATC TCCATCA CGCAAAT TAACCGT

 1* 010 01  011 01  011 02  012 02  
    ATTATAC CAAAAAA AAGGCTC AAGGAAT

***************************************************

c3.2.11

5'- TCTTTGATTAG  TTTT CTGGTTGATTCTAA TAGATGTGGCAA -3'
5'- TGCGAATAGTACCA TTTT GTGATACTACGTCT GAGAAGATGTGC -3'

***************************************************

c3.2.12

5'- TCTTTGATTAG  TTTT TCTATCCTTCACGA -3'
5'- TGCGAATAGTACCA TTTT ATAGATATGCAGGA -3'

***************************************************

c3.2.13

(none)

***************************************************

c3.2.14

5'- GGAAAGCGCAGT TTTT TTAGAATCAACCAG ATCGGTATGGCA -3'
5'- GCGCTTAATGCG  TTTT AGACGTAGTATCAC ATGCTCCACCCG -3'

***************************************************

c3.2.15

5'- GGAAAGCGCAGT TTTT TTAGAATCAACCAG -3'
5'- GCGCTTAATGCG   TTTT AGACGTAGTATCAC -3'

***************************************************

c3.2.16

                  5'- TCGTGAAATTCTAA TGGCCCCAATAC -3'
                  5'- CTGGTTGGGATAGA GAGCTGTTCACC -3'

                    5'- TCCTGCATACGTCT ATGCTCCACCCG -3'
                    5'- GTGATACTATCTAT GAGAAGATGTGC -3'

***************************************************

c3.2.17

5'- TGCCATACCGATCTGGTTGATTCTAAAAAAACTGCGCTTTCC -3' 
5'- TTGCCACATCTATTAGAATCAACCAGAAAACTAATCAAAGA -3'
5'- CGGGTGGAGCATGTGATACTACGTCTAAAACGCATTAAGCGC -3' 
5'- GCACATCTTCTCAGACGTAGTATCACAAAATGGTACTATTCGCA -3'

***************************************************

c3.2.18

5'- GTATTGGGGCCATTAGAATTTCACGA -3' 
5'- GGTGAACAGCTCTCTATCCCAACCAG -3'
5'- CGGGTGGAGCATAGACGTATGCAGGA -3' 
5'- GCACATCTTCTCATAGATAGTATCAC -3'