Hartings AU Photosynthesis Lab:Materials/Myoglobin/WT Sequence text

From OpenWetWare
Jump to: navigation, search
Hartings AU Photosynthesis Lab Header.png


ATGGTTCTGTCTGAAGGTGAATGGCAGCTGGTTCTGCATGTTTGGGCTAAAGTTGAAGCTGACGTCGCTGGTCATGGTCAGGACATCTTGATTCGACTGTTCAAATCTCATCCGGAAACTCTGGAAAAATTCGATCGTTTCAAACATCTGAAAACTGAAGCTGAAATGAAAGCTTCTGAAGATCTGAAAAAACATGGTGTTACCGTGTTAACTGCCCTAGGTGCTATCCTTAAGAAAAAAGGGCATCATGAAGCTGAGCTCAAACCGCTTGCGCAATCGCATGCTACTAAACATAAGATCCCGATCAAATACCTGGAATTCATCTCTGAAGCGATCATCCATGTTCTGCATTCTAGACATCCAGGTGACTTCGGTGCTGACGCTCAGGGTGCTATGAACAAAGCTCTCGAGCTGTTCCGTAAAGATATCGCTGCTAAGTACAAAGAACTGGGTTACCAGGGTTAATGA