Hartings AU Photosynthesis Lab:Materials/Hemoglobin/M33SM103S Sequence text

From OpenWetWare
Jump to navigationJump to search
Hartings AU Photosynthesis Lab Header.png



ATGGCGAATAAAACTAGAGAACTATGCATGAAATCACTCGAACATGCGAAGGTCGACACTAGTAACGAGGCGAGACAGGATGGCATCGACCTTTACAAACATAGCTTCGAGAACTACCCGCCATTGAGAAAATATTTCAAGAGCCGTGAAGAGTACACCGCCGAAGACGTACAGAATGATCCATTCTTCGCTAAGCAAGGACAGAAAATTCTCTTGGCATGCCACGTTCTTTGCGCCACCTACGATGACCGGGAAACATTTAACGCCTACACTAGAGAACTACTGGATCGTCACGCGAGGGACCATGTGCATAGCCCACCAGAAGTTTGGACTGACTTCTGGAAGCTCTTCGAAGAATACCTAGGCAAGAAAACGACACTCGATGAGCCCACGAAGCAAGCTTGGCATGAAATCGGCAGGGAGTTTGCGAAGGAAATCAACAAGCATGGACGATGA