Final Oligo List

From OpenWetWare
Jump to: navigation, search
c4.0.1: core barrel oligos
oligo 0 c4.0.1.1 AGCGTAACAAAAGG
oligo 3 c4.0.1.2 TTGATATTGAGTAACAGTGCCCGTATAAACAGTTAGCTTTTG
oligo 4 c4.0.1.3 ATGATACAGGAGTGTACTGGTGAGCCGCCGCCAGCATTGACA
oligo 5 c4.0.1.4 GGAGGTTGAACCGCCACCCTCAGAGCCACCACCCTTTAGCGT
oligo 6 c4.0.1.5 CAGACTGTAGCGCGTTTTCATATGAAACCATCGATATATTGA
oligo 8 c4.0.1.6 AAAGTTAATTGAGCGCTAATATCAGAGAGATAACCTTTACAG
oligo 9 c4.0.1.7 AGAGAATAACATAAAAACAGGCGTCTTTCCAGAGCCTAATTT
oligo 10 c4.0.1.8 GCCAGTTGGTTTTGAAGCCTTAAATCAAGATTAGTTTCATCG
oligo 12 c4.0.1.9 ACGCGCCGAGGCATTTTCGAGCGTTATACAAATTCATGGTTT
oligo 13 c4.0.1.10 GAAATACATGTAAATGCTGATGCAAATCCAATCGCGCGATAG
oligo 14 c4.0.1.11 CTTAGATTAAGACGCTGAGAAAATCAATATATGTGAGTGAAT
oligo 15 c4.0.1.12 AACCTTGATTTCAATTACCTGAGCAAAAGAAGATGGAGCTAA
oligo 16 c4.0.1.13 CTCACATTAATTGCGTTGCGCTAAAGGAATTGCGATTTTCTG
oligo 18 c4.0.1.14 GGGTTTTTTTCGGAACCTATTATTCTGAAACATGAGCGCAGT
oligo 19 c4.0.1.15 CTCTGAATTTACCGTTCCAGTGATTGGCCTTGATATTCACAA
oligo 20 c4.0.1.16 ACAAATAGAGCCACCACCGGAACCGCCTCCCTCAGATAGCCC
oligo 22 c4.0.1.17 CACCATTACCGACT
oligo 24 c4.0.1.18 TTACCGATAAGCCCAATAATAAGAGCAA
oligo 25 c4.0.1.19 GTGAGAATAGAAAGGAACAACTCACTGCCCGCTTTGAGGCGA
oliog 26 c4.0.1.20 ATTATTCCTTCTGTAAATCGTTCCTTGAAAACATAAAGACAA
oligo 28 c4.0.1.21 CTGACCTAAATTTATTACCAG
oligo 29 c4.0.1.22 TATAAAGCCAACGCTCAACAGTTAACAACGCCAACATGTAAT
oligo 30 c4.0.1.23 TTAGGCATGTTTATCAACAATAGATAAGTCCTGAATTACGAG
oligo 31 c4.0.1.24 CATGTAGAAACCAATCAATAAATAGCAAGCAAATCCCCGACT
oligo 32 c4.0.1.25 TGCGGGAACAAAATAAACAGCTGAAAATAGCAGCCCACAAGA
oligo 33 c4.0.1.26 ATTGAGTAGCCCTTTTTAAGAAAAGTAAGCAGATATATTACG
oligo 34 c4.0.1.27 CAGTATGTTAGCAAACGTAGATAAGTTTATTTTGTCACAATC
oligo 35 c4.0.1.28 AATAGAATATTCATTAAAGGTGAATTATCACCGTCACCATTA
oligo 37 c4.0.1.29 ACCCTCAGAGGCAGGTCAGACAAGCGTCATACATGATGCCCC
oligo 38 c4.0.1.30 CTGCCTAGCTCAGTACCAGGCGGATAAGTGCCGTCTTTAGTA
oligo 39 c4.0.1.31 CCGCCACCCTCAGAACCGCCAGAGTTTCGTCACCAGTACAAA
oligo 40 c4.0.1.32 CTACAACGTCGTCTTTCCAGACGTTAGTAAATGAAATAATAA
oligo 41 c4.0.1.33 TTTTTTCACGTTGAAAATCTCGGTGCCTAATGAGTATGAAAC
oligo 42 c4.0.1.34 AAACATCGGAAACAGTACATAGAGTCAATAGTGAAGGTTATA
oligo 44 c4.0.1.35 ATAAGGCGTTAAATCTAGAAA
oligo 45 c4.0.1.36 AAGCCTGTTTAGTATCATATGCCAGTAATAAGAGAATATAAA
oligo 46 c4.0.1.37 GTACCGACGACGACAATAAACAACATGTTCAGCTATTATCAT
oligo 48 c4.0.1.38 TTGCACCCCAACGCTAACGAGGAAGCGCATTAGACAAAGTCA
oligo 49 c4.0.1.39 GAGGGTACCAGAAGGAAACCGAGGAAAC
oligo 50 c4.0.1.40 AGCAAGCCCAATAGGAACCCATTTTGCTAAACAACTTTCAAC
oligo 51 c4.0.1.41 TGTATCAACAGACA
oligo 52 c4.0.1.39 CTCCTCAAGAGAAGGATTAGGACCCTCAGAGCCACCACCCTC
oligo 53 c4.0.1.42 AGTGCCTAAGTATA
oligo 54 c4.0.1.43 ATGGAAAAAGTATT
oligo 55 c4.0.1.44 ACCACCAAATAAGT
oligo 56 c4.0.1.45 GGAACCAAATCCTC
oligo 57 c4.0.1.46 TTTGCCTCAGAGCC
oligo 58 c4.0.1.47 AAAATCATTTCATA
oligo 59 c4.0.1.48 CGATTGAGGGAGGG
oligo 61 c4.0.1.49 AAACGCATTTGGGA
oligo 62 c4.0.1.50 GAATACCCAAAAGAACTGGCAACCAGCGCCAAAGACAAAAGG
oligo 63 c4.0.1.51 TAGCAATAGGTGGC
oligo 64 c4.0.1.52 CCTGAACGGGAGAA
oligo 65 c4.0.1.53 TTTTTTGTTTAACGTCAAAAACATATTATTTATCCCAATCCA
oligo 66 c4.0.1.54 AATCTTACAGCTAC
oligo 67 c4.0.1.55 GCGAGGCGTTTTAGCGAACCTAGATATAGAAGGCTTATCCGG
oligo 68 c4.0.1.56 AACAAGCAAGTACC
oligo 69 c4.0.1.57 TCCTAATCAAGAAA
oligo 70 c4.0.1.58 GTCCAGACAAAAGG
oligo 71 c4.0.1.59 GCCATATTAGGGCT
oligo 72 c4.0.1.60 ATAATTAAAGAATA
oligo 73 c4.0.1.61 TATTTTAGAGAAAA
oligo 74 c4.0.1.62 TTTAACCTCCGGCTTAGGTTGTTTATCAAAATCATAGGTCTG
oligo 75 c4.0.1.63 CTTAGAACGCTATT
oligo 76 c4.0.1.64 ATTTGAATTACCTTTTTTAATAAGAAAACAAAATTAATTACA
oligo 77 c4.0.1.65 TCGCGCACCAGTCG
c4.0.2: core top lid oligos
oligo 0 c4.0.2.1 TAAAGTATAGCATT
oligo 1 c4.0.2.2 TGGAAGTATGCTGTAGCTCAAAAAGACTTCAAATAAGCAAAG
oligo 3 c4.0.2.3 GAGAGGCTTACAACAT
oligo 4 c4.0.2.4 TATTACATTGGGAAGAAAAATACAAAGCTGCTCATTCTTGAC
oligo 5 c4.0.2.5 AAGAACCGTGTCGAAATCCGCACAAAGTACAACGGCTTTGAG
oligo 6 c4.0.2.6 GACTAAAGACTTTTTCATGAGGAAGTTTCCATTAAGACCCCC
oligo 7 c4.0.2.7 AGCGATTATACCAAGCGCGAAGACCTGCTCCATGTTACTTAG
oligo 8 c4.0.2.8 CCGGAACTAGGCTGGCTGACCTTCATCAAGAGTAATCAGTGA
oligo 9 c4.0.2.9 ATAAGGCTTGCCCTGACGAGAGAACTGGCTCATTATACCAGT
oligo 10 c4.0.2.10 CAGGACGGGTAGAAAGATTCATCAGTTGAGATTTACGTTTAC
oligo 11 c4.0.2.11 CAGACGACGATAAAAACCAAATTTAGACTGGATAGCGTCCAA
oligo 12 c4.0.2.12 TACTGCGGGTCTTTACCCTGACTATTATAGTCAGATCGCGTT
oligo 13 c4.0.2.13 TTAATTCGAGCTTCAAAGCGAATGGCTTAGAGCTTAATTGCT
oligo 14 c4.0.2.14 GAATATATTCATTCCATATAACAGTTGATTCCCAAGGGCGCG
oligo 15 c4.0.2.15 AGCTGAAAAGGTGGCATCAATTCTACTAATAGTAGCGGTGTC
oligo 16 c4.0.2.16 ATGGTCAATAACCTGTTTAGCTATATTTTCATTTGTTCTGCG
oligo 17 c4.0.2.17 AACGAGTGGTCATTTTTGCGGACCAGACCGGAAGCTAAATCA
oligo 18 c4.0.2.18 AAAATCAGAATCGTCATAAATACTATCATAACCCTGGAATAC
oligo 19 c4.0.2.19 CACATTCTTATGCGATTTTAAAACACCAGAACGAGACAGACC
oligo 20 c4.0.2.20 AGGCGCAGAGGCGCAGACGGTAAACACTCATCTTTACGGGTA
oligo 21 c4.0.2.21 AAATACGTAATGCCACTACGAAGGCACC
oligo 22 c4.0.2.22 TAATTGCTCCTTTTGATAAGAAGATTTAGTTTGACCATTAGA
olgio 23 c4.0.2.23 AAGCCCGCATGTTT
oligo 24 c4.0.2.24 TTCAGAAAACGAGAATGACCAAAACTCCAACAGGTCAGGATT
oligo 25 c4.0.2.25 AGAGGGGCATCAAA
oligo 26 c4.0.2.26 ACGAGGCATAGTAAGAGCAACATTCATTGAATCCCCCTCAAA
oligo 27 c4.0.2.27 TAACGGATTGCAAA
oligo 28 c4.0.2.28 CTTTAATCATTGTGAATTACCAACTAAT
oligo 30 c4.0.2.29 CAACGTACTACGTT
oligo 31 c4.0.2.30 AAGAGGACAGATGAACGGTGTTAGTAAATTGGGCTTGAGATG
oligo 32 c4.0.2.31 ATAAATTGGATATT
oligo 33 c4.0.2.32 AAGAGGCAAAAGAATACACTACAATCATAAGGGAACCGAACT
oligo 34 c4.0.2.33 ACAGAGGAGATTTG
c4.0.3: core bottom lid oligos
oligo 0 c4.0.3.1 ATACATTGGCAATT
oligo 1 c4.0.3.2 TTAGAAGTAACAACTAATAGAAGTGCCACGCTGAGAAACAGA
oligo 3 c4.0.3.3 ACCAGTCAACATCA
oligo 4 c4.0.3.4 CTTGCCTGCAAATTAACCGTTGAGCACGTATAACGTAATGCG
oligo 5 c4.0.3.5 CCGCTACCGGAACCCTAAAGGATCAAGTTTTTTGGATCCCTT
oligo 6 c4.0.3.6 ATAAATCAAAAGAATAGCCCGAGATAGGGTTGAGTATGGCCC
oligo 7 c4.0.3.7 ACTACGTGAACCATCACCCAAGAGCCCCCGATTTAGAGCTTG
oligo 8 c4.0.3.8 ACGGGGATGCGCGTAACCACCACACCCGCCGCGCTTGCTTTC
oligo 9 c4.0.3.9 CTCGTTAGAATCAGAGCGGGACCACCGAGTAAAAGAGTCTGT
oligo 10 c4.0.3.10 CCATCACGAGTAGAAGAACTCAAACTATCGGCCTTATCGTCT
oligo 11 c4.0.3.11 GAAATGGATTATTTACATTGGTAGAACCCTTCTGACCTGAAA
oligo 12 c4.0.3.12 GCGTAAGATACCGAACGAACCACCAGCAGAAGATAAGCCAGC
oligo 13 c4.0.3.13 AGCAAATGAAAAATCTAAAGCAGGTTATCTAAAATATCTTT
oligo 14 c4.0.3.14 GGAGCACTATTAGACTTTACAAACAATTCGACAACGAAGGAG
oligo 15 c4.0.3.15 CGGAATTATCATCATATTCCTGATTATCAGATGATTGAGGAT
oligo 16 c4.0.3.16 TAACATTATCATTTTGCGGAACAAAGAAACCACCATCGTATT
oligo 17 c4.0.3.17 AAATCCTAAAGGAATTGAGGAATCACCTTGCTGAACATCGCC
oligo 18 c4.0.3.18 ATTAAAAAATACGTGGCACAGCATTTTGACGCTCAGCTGGTA
oligo 19 c4.0.3.19 ATATCCATATAATCAGTGAGGGCTAAACAGGAGGCTGTAGCG
oligo 20 c4.0.3.20 GTCACGCAAGCCGGCGAACGTCGTCTATCAGGGCGGTTGTTC
oligo 21 c4.0.3.21 CAGTTTGGAACAAGAGTCCACTATTAAA
oligo 22 c4.0.3.22 CAGTTGGCAAATCAACAGTTGTTGCCCGAACGTTATTAATTT
olgio 23 c4.0.3.23 CTGCAACTTAGAGC
oligo 24 c4.0.3.24 CGCGAACTGATAGCCCTAAAACCTCAAATATCAAACCCTCAA
oligo 25 c4.0.3.25 GGACATTCGGTCAG
oligo 26 c4.0.3.26 AAACGCTCATGGAAATACCTAACAATATTTTTGAATGGCTAT
oligo 27 c4.0.3.27 TAGTAATACACGAC
oligo 28 c4.0.3.28 CAGAATCCTGAGAAGTGTTTTGAACAAT
oligo 30 c4.0.3.29 CTTTGACGTAGCAA
oligo 31 c4.0.3.30 GGGCGCTAGGGCGCTGGCAAGCGATTAAAGGGATTTTAGACA
oligo 32 c4.0.3.31 ACTAAATAGGGCGC
oligo 33 c4.0.3.32 CAACGTCAAAGGGCGAAAAACGGCGAGAAAGGAAGGGAAGAA
oligo 34 c4.0.3.33 CGGCAAAGGTCGAG
c4.0.4: barrel oligos @ outside aptamers -aptamers
oligo 2 c4.0.4.1 AAGTTTTGCCTGTAGCATTCCCCGTACTCAGGAGGGAGAGGG
oligo 7 c4.0.4.2 CGGAAATAATTCATATGGTTTTGATTAAGACTCCTGCCGAAC
oligo 17 c4.0.4.3 TATGGGATGTACCGTAACACTCCCTCAGAACCGCCATTAGCG
oligo 23 c4.0.4.4 TGAGCCAAAGACACCACGGAAAAATACATACATAAAGCTATC
c4.0.5: barrel oligos @ outside aptamers +aptamers
oligo 2 c4.0.5.1 AAGTTTTGCCTGTAGCATTCCCCGTACTCAGGAGGGAGAGGGTTTGGTTGGTGTGGTTGG
oligo 7 c4.0.5.2 CGGAAATAATTCATATGGTTTTGATTAAGACTCCTGCCGAACTTTGGTTGGTGTGGTTGG
oligo 17 c4.0.5.3 TATGGGATGTACCGTAACACTCCCTCAGAACCGCCATTAGCGTTTGGTTGGTGTGGTTGG
oligo 23 c4.0.5.4 TGAGCCAAAGACACCACGGAAAAATACATACATAAAGCTATCTTTGGTTGGTGTGGTTGG
c4.0.6: barrel oligos @ inside aptamers -aptamers
oligo 1 c4.0.6.1 AGCATAAAGTGTAAAGCCTGGCAAAAAAAAGGCTCCGATCTA
oligo 11 c4.0.6.2 TAGGAATCATTACCGCGCCCATCGGCTGTCTTTCCATGCAGA
oligo 36 c4.0.6.3 GCAAGGCCGGAAACGTCACCACGGCATTTTCGGTCAGCCGCC
oligo 47 c4.0.6.4 TCCAAGAACGGGTATTAAACCAAGCCGTTTTTATTTGCTATT
c4.0.7: barrel oligos @ inside aptamers +aptamers
oligo 1 c4.0.7.1 AGCATAAAGTGTAAAGCCTGGCAAAAAAAAGGCTCCGATCTATTTGGTTGGTGTGGTTGG
oligo 11 c4.0.7.2 TAGGAATCATTACCGCGCCCATCGGCTGTCTTTCCATGCAGATTTGGTTGGTGTGGTTGG
oligo 36 c4.0.7.3 GCAAGGCCGGAAACGTCACCACGGCATTTTCGGTCAGCCGCCTTTGGTTGGTGTGGTTGG
oligo 47 c4.0.7.4 TCCAAGAACGGGTATTAAACCAAGCCGTTTTTATTTGCTATTTTTGGTTGGTGTGGTTGG
c4.0.8: two-oligo latch sequences for barrel
oligo 21 c4.0.8.1 CCTTATTAGCGTTTGCCATCTCCAGTAGTTTTTTTTTTTCGAGTTGACAAAGCTACCGGTTCAAG
oligo 27 c4.0.8.2 AGAACGCGTTAATTTCATCTTTTTTTTTTTTTTTTCAGGATACCATCATCTACTAACCGGTG
oligo 43 c4.0.8.3 TAACTATCGACCGTGTGATAATTTTTTTTTTTTTGTACGCATGGCAAATTACCACTCTAGC
oligo 60 c4.0.8.4 AAGGTAAAGCAGCACCGTAATTTTTTTTGTAACGAAGTTGCACCACACAACGCTA
c4.0.9: four-oligo latch sequences for barrel
oligo 21 c4.0.9.1 CCTTATTAGCGTTTGCCATCTCCAGTAGTTTTTTTTTTGGCACTCCTACAATT
oligo 27 c4.0.9.2 AGAACGCGTTAATTTCATCTTTTTTTTTTTTTTTTGACGATAGGGAAACA
oligo 43 c4.0.9.3 TAACTATCGACCGTGTGATAATTTTTTTTTTTTTTGGATCGGTACATTGT
oligo 60 c4.0.9.4 AAGGTAAAGCAGCACCGTAATTTTTTTTCCGGTGCAGAAGTTT
c4.0.10: barrel oligos @ latches -latches
oligo 21 c4.0.10.1 CCTTATTAGCGTTTGCCATCTCCAGTAG
oligo 27 c4.0.10.2 AGAACGCGTTAATTTCATCTT
oligo 43 c4.0.10.3 TAACTATCGACCGTGTGATAA
oligo 60 c4.0.10.4 AAGGTAAAGCAGCACCGTAAT
c4.0.11: two-oligo latch sequences for top lid
oligo 2 c4.0.11.1 CGGATTGGTAATAGTAAAATGATAGCGATTTTTTTGTGCAACTTCGTTACACGAGTAATGCG
oligo 29 c4.0.11.2 GCAGATACATAACGTTTTTTTTTTTTTTATTTGCCATGCGTACCGGTTAGATAGC
c4.0.12: two-oligo latch sequences for bottom lid
oligo 2 c4.0.12.1 GGTGAGGCTGGCCAACAGAGACAGATTCTTTTTTTTTTTGCTTTGTCAACTCGAACTGGCCCTTAA
oligo 29 c4.0.12.2 ATTACCGCCAGCCATTTTTTTTTTTTTTGATGATGGTATCCTGGTGGAGTAGTTG
c4.0.13: four-oligo latch sequences for top lid
oligo 2 c4.0.13.1 CGGATTGGTAATAGTAAAATGATAGCGATTTTTTTTAGAGACGACCATAC
oligo 29 c4.0.13.2 GCAGATACATAACGTTTTTTTTTTTTTTAGGCAACTCGAATAC
c4.0.14: four-oligo latch seequences for bottom lid
oligo 2 c4.0.14.1 GGTGAGGCTGGCCAACAGAGACAGATTCTTTTTTTTTTTGTAGTAGAGACCAAC
oligo 29 c4.0.14.2 ATTACCGCCAGCCATTTTTTTTTTTTTTCCTACGAGAAGATCA
c4.0.15: top lid oligos @ latches -latches
oligo 2 c4.0.15.1 CGGATTGGTAATAGTAAAATGATAGCGA
oligo 29 c4.0.15.2 GCAGATACATAACG
c4.0.16: bottom lid oligos @ latches -latches
oligo 2 c4.0.16.1 GGTGAGGCTGGCCAACAGAGACAGATTC
oligo 29 c4.0.16.2 ATTACCGCCAGCCA
c4.0.17: two-oligo latch barrel displacement oligos
for oligo 21 c4.0.17.1 CTTGAACCGGTAGCTTTGTCAACTCGA
for oligo 27 c4.0.17.2 CACCGGTTAGTAGATGATGGTATCCTG
for oligo 43 c4.0.17.3 GCTAGAGTGGTAATTTGCCATGCGTAC
for oligo 60 c4.0.17.4 TAGCGTTGTGTGGTGCAACTTCGTTAC
c4.0.18: two-oligo latch top lid displacement oligos
for oligo 2 c4.0.18.1 CGCATTACTCGTGTAACGAAGTTGCAC
for oligo 29 c4.0.18.2 GCTATCTAACCGGTACGCATGGCAAAT
c4.0.19: two-oligo latch bottom lid displacement oligos
for oligo 2 c4.0.19.1 TTAAGGGCCAGTTCGAGTTGACAAAGC
for oligo 29 c4.0.19.2 CAACTACTCCACCAGGATACCATCATC
c4.0.20: four-oligo latch barrel displacement oligos
for oligo 21 c4.0.20.1 TTATTGCCGTGCGGCACTCAGACCAAC
for oligo 27 c4.0.20.2 ATCGCTCACAACGACGATAGAAGATCA
for oligo 43 c4.0.20.3 CCTAGAAAGTCCGGATCGGTCGAATAC
for oligo 60 c4.0.20.4 TAGCGGTACTCACCGGTGCGACCATAC
c4.0.21: four-oligo latch top lid displacement oligos
for oligo 2 c4.0.21.1 CGACTGAAGAGATAGAGACAGAAGTTT
for oligo 29 c4.0.21.2 GTACCCTTAACCAGGCAACTACATTGT
c4.0.22: four-oligo latch bottom lid displacement oligos
for oligo 2 c4.0.22.1 GAATAGCCTTCGGTAGTAGCTACAATT
for oligo 29 c4.0.22.2 CACAAGCACTGACCTACGAGGGAAACA
c4.0.23: barrel zipper oligos
for oligo 21 c4.0.23.1 GTTGGTCTGAGTGCCGCACGGCAATAA
for oligo 27 c4.0.23.2 TGATCTTCTATCGTCGTTGTGAGCGAT
for oligo 43 c4.0.23.3 GTATTCGACCGATCCGGACTTTCTAGG
for oligo 60 c4.0.23.4 GTATGGTCGCACCGGTGAGTACCGCTA
c4.0.24: top lid zipper oligos
for oligo 2 c4.0.24.1 AAACTTCTGTCTCTATCTCTTCAGTCG
for oligo 29 c4.0.24.2 ACAATGTAGTTGCCTGGTTAAGGGTAC
c4.0.25: bottom lid zipper oligos
for oligo 2 c4.0.25.1 AATTGTAGCTACTACCGAAGGCTATTC
for oligo 29 c4.0.25.2 TGTTTCCCTCGTAGGTCAGTGCTTGTG